ID: 1119688090

View in Genome Browser
Species Human (GRCh38)
Location 14:76648886-76648908
Sequence CACTTGAATCCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119688081_1119688090 17 Left 1119688081 14:76648846-76648868 CCTAAAGCCCCAGCTACTCAGCA No data
Right 1119688090 14:76648886-76648908 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
1119688083_1119688090 10 Left 1119688083 14:76648853-76648875 CCCCAGCTACTCAGCAGGCTAAG 0: 3
1: 118
2: 2523
3: 4638
4: 5761
Right 1119688090 14:76648886-76648908 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
1119688084_1119688090 9 Left 1119688084 14:76648854-76648876 CCCAGCTACTCAGCAGGCTAAGG 0: 36
1: 4834
2: 112351
3: 215635
4: 243211
Right 1119688090 14:76648886-76648908 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042
1119688086_1119688090 8 Left 1119688086 14:76648855-76648877 CCAGCTACTCAGCAGGCTAAGGC 0: 29
1: 3742
2: 97774
3: 203595
4: 233729
Right 1119688090 14:76648886-76648908 CACTTGAATCCAGGAGACGGAGG 0: 22
1: 910
2: 11219
3: 45370
4: 97042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119688090 Original CRISPR CACTTGAATCCAGGAGACGG AGG Intergenic
Too many off-targets to display for this crispr