ID: 1119691197

View in Genome Browser
Species Human (GRCh38)
Location 14:76674053-76674075
Sequence CCTTTAAGGCAAAAGCCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119691197_1119691205 22 Left 1119691197 14:76674053-76674075 CCTGTTGGCTTTTGCCTTAAAGG No data
Right 1119691205 14:76674098-76674120 CTCAAACACAGGCTCCTCCGAGG No data
1119691197_1119691202 11 Left 1119691197 14:76674053-76674075 CCTGTTGGCTTTTGCCTTAAAGG No data
Right 1119691202 14:76674087-76674109 TATCACTTACCCTCAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119691197 Original CRISPR CCTTTAAGGCAAAAGCCAAC AGG (reversed) Intergenic
No off target data available for this crispr