ID: 1119692076

View in Genome Browser
Species Human (GRCh38)
Location 14:76681319-76681341
Sequence GACTTTCCATAGGAACAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119692076_1119692080 -1 Left 1119692076 14:76681319-76681341 CCCACCTGTTCCTATGGAAAGTC No data
Right 1119692080 14:76681341-76681363 CAGTTTTGTGAAAGCTTCATAGG No data
1119692076_1119692081 0 Left 1119692076 14:76681319-76681341 CCCACCTGTTCCTATGGAAAGTC No data
Right 1119692081 14:76681342-76681364 AGTTTTGTGAAAGCTTCATAGGG No data
1119692076_1119692082 1 Left 1119692076 14:76681319-76681341 CCCACCTGTTCCTATGGAAAGTC No data
Right 1119692082 14:76681343-76681365 GTTTTGTGAAAGCTTCATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119692076 Original CRISPR GACTTTCCATAGGAACAGGT GGG (reversed) Intergenic
No off target data available for this crispr