ID: 1119692227

View in Genome Browser
Species Human (GRCh38)
Location 14:76683514-76683536
Sequence GTCTTTCAATGATAGATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119692227_1119692234 18 Left 1119692227 14:76683514-76683536 CCCTACATCTATCATTGAAAGAC No data
Right 1119692234 14:76683555-76683577 TCACATGGCAGCCATGGCAAGGG No data
1119692227_1119692232 12 Left 1119692227 14:76683514-76683536 CCCTACATCTATCATTGAAAGAC No data
Right 1119692232 14:76683549-76683571 GCTTCTTCACATGGCAGCCATGG No data
1119692227_1119692233 17 Left 1119692227 14:76683514-76683536 CCCTACATCTATCATTGAAAGAC No data
Right 1119692233 14:76683554-76683576 TTCACATGGCAGCCATGGCAAGG No data
1119692227_1119692229 -10 Left 1119692227 14:76683514-76683536 CCCTACATCTATCATTGAAAGAC No data
Right 1119692229 14:76683527-76683549 ATTGAAAGACAAGCCAACACAGG No data
1119692227_1119692231 3 Left 1119692227 14:76683514-76683536 CCCTACATCTATCATTGAAAGAC No data
Right 1119692231 14:76683540-76683562 CCAACACAGGCTTCTTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119692227 Original CRISPR GTCTTTCAATGATAGATGTA GGG (reversed) Intergenic
No off target data available for this crispr