ID: 1119693500

View in Genome Browser
Species Human (GRCh38)
Location 14:76694897-76694919
Sequence CACACAGATGTACCACAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119693493_1119693500 13 Left 1119693493 14:76694861-76694883 CCCTGCATGTCGGCATGCGGAAC No data
Right 1119693500 14:76694897-76694919 CACACAGATGTACCACAGTCGGG No data
1119693490_1119693500 30 Left 1119693490 14:76694844-76694866 CCACGTGGGAAGGAAGACCCTGC No data
Right 1119693500 14:76694897-76694919 CACACAGATGTACCACAGTCGGG No data
1119693494_1119693500 12 Left 1119693494 14:76694862-76694884 CCTGCATGTCGGCATGCGGAACC No data
Right 1119693500 14:76694897-76694919 CACACAGATGTACCACAGTCGGG No data
1119693495_1119693500 -9 Left 1119693495 14:76694883-76694905 CCCCACCAGCAGCACACACAGAT No data
Right 1119693500 14:76694897-76694919 CACACAGATGTACCACAGTCGGG No data
1119693496_1119693500 -10 Left 1119693496 14:76694884-76694906 CCCACCAGCAGCACACACAGATG No data
Right 1119693500 14:76694897-76694919 CACACAGATGTACCACAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119693500 Original CRISPR CACACAGATGTACCACAGTC GGG Intergenic
No off target data available for this crispr