ID: 1119693647

View in Genome Browser
Species Human (GRCh38)
Location 14:76695785-76695807
Sequence CAGGGAAGAAACCCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119693647_1119693653 2 Left 1119693647 14:76695785-76695807 CCCTCCTCAGGGTTTCTTCCCTG No data
Right 1119693653 14:76695810-76695832 CACCTCTGCTCAGCCACACAGGG No data
1119693647_1119693652 1 Left 1119693647 14:76695785-76695807 CCCTCCTCAGGGTTTCTTCCCTG No data
Right 1119693652 14:76695809-76695831 TCACCTCTGCTCAGCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119693647 Original CRISPR CAGGGAAGAAACCCTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr