ID: 1119693653

View in Genome Browser
Species Human (GRCh38)
Location 14:76695810-76695832
Sequence CACCTCTGCTCAGCCACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119693639_1119693653 16 Left 1119693639 14:76695771-76695793 CCCCGTCCCAGTTCCCCTCCTCA No data
Right 1119693653 14:76695810-76695832 CACCTCTGCTCAGCCACACAGGG No data
1119693637_1119693653 29 Left 1119693637 14:76695758-76695780 CCCAGAGACAAGGCCCCGTCCCA No data
Right 1119693653 14:76695810-76695832 CACCTCTGCTCAGCCACACAGGG No data
1119693638_1119693653 28 Left 1119693638 14:76695759-76695781 CCAGAGACAAGGCCCCGTCCCAG No data
Right 1119693653 14:76695810-76695832 CACCTCTGCTCAGCCACACAGGG No data
1119693641_1119693653 14 Left 1119693641 14:76695773-76695795 CCGTCCCAGTTCCCCTCCTCAGG No data
Right 1119693653 14:76695810-76695832 CACCTCTGCTCAGCCACACAGGG No data
1119693644_1119693653 10 Left 1119693644 14:76695777-76695799 CCCAGTTCCCCTCCTCAGGGTTT No data
Right 1119693653 14:76695810-76695832 CACCTCTGCTCAGCCACACAGGG No data
1119693647_1119693653 2 Left 1119693647 14:76695785-76695807 CCCTCCTCAGGGTTTCTTCCCTG No data
Right 1119693653 14:76695810-76695832 CACCTCTGCTCAGCCACACAGGG No data
1119693649_1119693653 -2 Left 1119693649 14:76695789-76695811 CCTCAGGGTTTCTTCCCTGTTCA No data
Right 1119693653 14:76695810-76695832 CACCTCTGCTCAGCCACACAGGG No data
1119693648_1119693653 1 Left 1119693648 14:76695786-76695808 CCTCCTCAGGGTTTCTTCCCTGT No data
Right 1119693653 14:76695810-76695832 CACCTCTGCTCAGCCACACAGGG No data
1119693640_1119693653 15 Left 1119693640 14:76695772-76695794 CCCGTCCCAGTTCCCCTCCTCAG No data
Right 1119693653 14:76695810-76695832 CACCTCTGCTCAGCCACACAGGG No data
1119693646_1119693653 3 Left 1119693646 14:76695784-76695806 CCCCTCCTCAGGGTTTCTTCCCT No data
Right 1119693653 14:76695810-76695832 CACCTCTGCTCAGCCACACAGGG No data
1119693645_1119693653 9 Left 1119693645 14:76695778-76695800 CCAGTTCCCCTCCTCAGGGTTTC No data
Right 1119693653 14:76695810-76695832 CACCTCTGCTCAGCCACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119693653 Original CRISPR CACCTCTGCTCAGCCACACA GGG Intergenic
No off target data available for this crispr