ID: 1119700760

View in Genome Browser
Species Human (GRCh38)
Location 14:76753015-76753037
Sequence TGGATCCTCTCCCCGTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119700760_1119700773 25 Left 1119700760 14:76753015-76753037 CCCCTCAACGGGGAGAGGATCCA No data
Right 1119700773 14:76753063-76753085 GCACAACTGATGGGTAGGAAGGG No data
1119700760_1119700766 15 Left 1119700760 14:76753015-76753037 CCCCTCAACGGGGAGAGGATCCA No data
Right 1119700766 14:76753053-76753075 CCCTTTCCCAGCACAACTGATGG No data
1119700760_1119700772 24 Left 1119700760 14:76753015-76753037 CCCCTCAACGGGGAGAGGATCCA No data
Right 1119700772 14:76753062-76753084 AGCACAACTGATGGGTAGGAAGG No data
1119700760_1119700769 20 Left 1119700760 14:76753015-76753037 CCCCTCAACGGGGAGAGGATCCA No data
Right 1119700769 14:76753058-76753080 TCCCAGCACAACTGATGGGTAGG No data
1119700760_1119700768 16 Left 1119700760 14:76753015-76753037 CCCCTCAACGGGGAGAGGATCCA No data
Right 1119700768 14:76753054-76753076 CCTTTCCCAGCACAACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119700760 Original CRISPR TGGATCCTCTCCCCGTTGAG GGG (reversed) Intergenic