ID: 1119700761

View in Genome Browser
Species Human (GRCh38)
Location 14:76753016-76753038
Sequence GTGGATCCTCTCCCCGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119700761_1119700772 23 Left 1119700761 14:76753016-76753038 CCCTCAACGGGGAGAGGATCCAC No data
Right 1119700772 14:76753062-76753084 AGCACAACTGATGGGTAGGAAGG No data
1119700761_1119700766 14 Left 1119700761 14:76753016-76753038 CCCTCAACGGGGAGAGGATCCAC No data
Right 1119700766 14:76753053-76753075 CCCTTTCCCAGCACAACTGATGG No data
1119700761_1119700768 15 Left 1119700761 14:76753016-76753038 CCCTCAACGGGGAGAGGATCCAC No data
Right 1119700768 14:76753054-76753076 CCTTTCCCAGCACAACTGATGGG No data
1119700761_1119700769 19 Left 1119700761 14:76753016-76753038 CCCTCAACGGGGAGAGGATCCAC No data
Right 1119700769 14:76753058-76753080 TCCCAGCACAACTGATGGGTAGG No data
1119700761_1119700773 24 Left 1119700761 14:76753016-76753038 CCCTCAACGGGGAGAGGATCCAC No data
Right 1119700773 14:76753063-76753085 GCACAACTGATGGGTAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119700761 Original CRISPR GTGGATCCTCTCCCCGTTGA GGG (reversed) Intergenic