ID: 1119700762

View in Genome Browser
Species Human (GRCh38)
Location 14:76753017-76753039
Sequence GGTGGATCCTCTCCCCGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119700762_1119700772 22 Left 1119700762 14:76753017-76753039 CCTCAACGGGGAGAGGATCCACC No data
Right 1119700772 14:76753062-76753084 AGCACAACTGATGGGTAGGAAGG No data
1119700762_1119700768 14 Left 1119700762 14:76753017-76753039 CCTCAACGGGGAGAGGATCCACC No data
Right 1119700768 14:76753054-76753076 CCTTTCCCAGCACAACTGATGGG No data
1119700762_1119700769 18 Left 1119700762 14:76753017-76753039 CCTCAACGGGGAGAGGATCCACC No data
Right 1119700769 14:76753058-76753080 TCCCAGCACAACTGATGGGTAGG No data
1119700762_1119700766 13 Left 1119700762 14:76753017-76753039 CCTCAACGGGGAGAGGATCCACC No data
Right 1119700766 14:76753053-76753075 CCCTTTCCCAGCACAACTGATGG No data
1119700762_1119700773 23 Left 1119700762 14:76753017-76753039 CCTCAACGGGGAGAGGATCCACC No data
Right 1119700773 14:76753063-76753085 GCACAACTGATGGGTAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119700762 Original CRISPR GGTGGATCCTCTCCCCGTTG AGG (reversed) Intergenic