ID: 1119700768

View in Genome Browser
Species Human (GRCh38)
Location 14:76753054-76753076
Sequence CCTTTCCCAGCACAACTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119700761_1119700768 15 Left 1119700761 14:76753016-76753038 CCCTCAACGGGGAGAGGATCCAC No data
Right 1119700768 14:76753054-76753076 CCTTTCCCAGCACAACTGATGGG No data
1119700760_1119700768 16 Left 1119700760 14:76753015-76753037 CCCCTCAACGGGGAGAGGATCCA No data
Right 1119700768 14:76753054-76753076 CCTTTCCCAGCACAACTGATGGG No data
1119700762_1119700768 14 Left 1119700762 14:76753017-76753039 CCTCAACGGGGAGAGGATCCACC No data
Right 1119700768 14:76753054-76753076 CCTTTCCCAGCACAACTGATGGG No data
1119700764_1119700768 -7 Left 1119700764 14:76753038-76753060 CCAGAAACATGTCTTCCCTTTCC No data
Right 1119700768 14:76753054-76753076 CCTTTCCCAGCACAACTGATGGG No data
1119700763_1119700768 -4 Left 1119700763 14:76753035-76753057 CCACCAGAAACATGTCTTCCCTT No data
Right 1119700768 14:76753054-76753076 CCTTTCCCAGCACAACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119700768 Original CRISPR CCTTTCCCAGCACAACTGAT GGG Intergenic