ID: 1119705444

View in Genome Browser
Species Human (GRCh38)
Location 14:76780053-76780075
Sequence TGGGCCAGTCACTTGTGGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 533}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119705431_1119705444 25 Left 1119705431 14:76780005-76780027 CCTTCCATTCTTTAACAGCCCAT 0: 1
1: 0
2: 0
3: 10
4: 174
Right 1119705444 14:76780053-76780075 TGGGCCAGTCACTTGTGGCAGGG 0: 1
1: 0
2: 3
3: 37
4: 533
1119705438_1119705444 6 Left 1119705438 14:76780024-76780046 CCATCTTGGCTTGGGGTTGCAAT 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1119705444 14:76780053-76780075 TGGGCCAGTCACTTGTGGCAGGG 0: 1
1: 0
2: 3
3: 37
4: 533
1119705432_1119705444 21 Left 1119705432 14:76780009-76780031 CCATTCTTTAACAGCCCATCTTG 0: 1
1: 0
2: 3
3: 21
4: 172
Right 1119705444 14:76780053-76780075 TGGGCCAGTCACTTGTGGCAGGG 0: 1
1: 0
2: 3
3: 37
4: 533
1119705437_1119705444 7 Left 1119705437 14:76780023-76780045 CCCATCTTGGCTTGGGGTTGCAA 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1119705444 14:76780053-76780075 TGGGCCAGTCACTTGTGGCAGGG 0: 1
1: 0
2: 3
3: 37
4: 533
1119705430_1119705444 29 Left 1119705430 14:76780001-76780023 CCTGCCTTCCATTCTTTAACAGC 0: 1
1: 0
2: 0
3: 19
4: 223
Right 1119705444 14:76780053-76780075 TGGGCCAGTCACTTGTGGCAGGG 0: 1
1: 0
2: 3
3: 37
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119705444 Original CRISPR TGGGCCAGTCACTTGTGGCA GGG Exonic
901108920 1:6779925-6779947 TGGGCAAATCACTTGAGGCCAGG - Intergenic
901738198 1:11325544-11325566 TGGGCGGATCACTTGTGGCCAGG + Intergenic
902188630 1:14744499-14744521 TAGGACAGTCACTTGAGGCTAGG + Intronic
902233711 1:15044350-15044372 TGGCCCAGTCTCTGGGGGCATGG - Intronic
902341599 1:15786902-15786924 TGGGCGGGTCACTTGAGGCCAGG + Intergenic
902393433 1:16119263-16119285 TGGGCATGTCCCTTGTGTCACGG - Intergenic
902935038 1:19758871-19758893 TGGGCCAATCACTTGAGGTCAGG + Intronic
903111999 1:21143689-21143711 TGGGCAAATCACTTGAGGCCAGG + Intronic
903445453 1:23419607-23419629 TGGGCGGGTCACTTGAGGCCAGG + Intronic
903527445 1:24002582-24002604 TGGGCAGATCACTTGAGGCAAGG + Intergenic
904065768 1:27749581-27749603 TGGGCAGGTCACTTGAGGCCAGG - Intronic
904408205 1:30307649-30307671 TAAGCCAGTCAATTGTGACAAGG + Intergenic
904674485 1:32190462-32190484 TGGCCCAGTCATTTGGGACAAGG - Intronic
904723537 1:32529517-32529539 TGGGCCGATCACTTGAGGCCAGG - Intronic
904875197 1:33649414-33649436 TGGGCAGGTCACTTGAGGCCAGG + Intronic
905431102 1:37924394-37924416 TGGGCGGGTCACTTGAGGCCAGG - Intronic
905772375 1:40646674-40646696 TGGGCAGGTCTCTTTTGGCATGG - Intronic
905870606 1:41402070-41402092 TGGGCCAATCAGCTGTGGCCAGG - Intergenic
906238063 1:44223678-44223700 TGGGACATTCACTTGGGCCAGGG - Intronic
906470710 1:46128205-46128227 TGGGCAGATCACTTGAGGCAAGG + Intronic
906657574 1:47559796-47559818 TAGGCAAGTCACTTGAGGCCAGG - Intergenic
907211353 1:52825726-52825748 TGGGAAAGTCACTTGAGGCCAGG - Exonic
907820455 1:57962642-57962664 TGGGAGAATCACTTGAGGCAAGG + Intronic
908218247 1:61977315-61977337 TGGGCCAATTACTTGAGGCTAGG - Intronic
908523821 1:64968702-64968724 TGGGCCAATCACTTGAGGTCAGG + Intergenic
908824879 1:68123714-68123736 TGTGCCAGTCACCTGTGACCAGG - Intronic
909013507 1:70359023-70359045 TGGGCAAGTCACTTGAGGTCAGG + Intronic
910849106 1:91633917-91633939 TGGGCGAATCACTTGAGGCCAGG - Intergenic
910934800 1:92479091-92479113 TGGGCGAATCACTTGAGGCCAGG - Intronic
910947331 1:92608474-92608496 TGGGCAGATCACTTGTGGCCAGG + Intronic
911079001 1:93909549-93909571 AGGGCCAGTCACTTGCGGGCCGG - Intergenic
912020051 1:105097047-105097069 TGGGATAGTCACTTGAGCCAGGG - Intergenic
912632534 1:111258108-111258130 TGGACCAGCCAGTTGTGCCATGG + Intergenic
913140580 1:115937478-115937500 TGGGCAAATCACTTGAGGCCAGG + Intergenic
913588767 1:120302526-120302548 TGGGCCAATCACTTGAGGTCGGG + Intergenic
913619418 1:120595843-120595865 TGGGCCAATCACTTGAGGTCGGG - Intergenic
914570789 1:148914397-148914419 TGGGCCAATCACTTGAGGTCAGG + Intronic
914602041 1:149215866-149215888 TGGGCCAATCACTTGAGGTCAGG - Intergenic
914821376 1:151106563-151106585 TGGGCGAATCACTTGAGGCCAGG - Intronic
915335913 1:155141128-155141150 TGGGCCAGTCACTTGAGGTCAGG - Intergenic
915718334 1:157965102-157965124 TGGGCAAGTCAGGTGTGGCTTGG + Intergenic
916096444 1:161355754-161355776 TGGGCGAATCACTTGAGGCCAGG + Intronic
916804025 1:168241418-168241440 TGGGCCAATCACTTGAGGTCAGG - Intronic
919099677 1:193079314-193079336 TGGGCGGATCACTTGAGGCAAGG - Intronic
919917709 1:202149080-202149102 TGGGCCAATCACTTGAGGTCAGG - Intronic
920137733 1:203783517-203783539 TGGGCAAATCACTTGAGGCCAGG - Intergenic
920983236 1:210858381-210858403 TGGTCCACTCACTTCTGACAGGG - Intronic
922164972 1:223107972-223107994 TGGGCCAATCACTTGAGGTCAGG - Intergenic
922656594 1:227389942-227389964 TGGGCGGGTCACTTGAGGCCAGG - Intergenic
923466532 1:234252295-234252317 TGGGCGAATCACTTGAGGCCAGG - Intronic
923535761 1:234850410-234850432 TGGGCCGATCACTTGAGGCCAGG - Intergenic
924103943 1:240632047-240632069 TGGGTGAGTCACTTGGGGCTAGG - Intergenic
924139607 1:241008683-241008705 TGGGCCCATCACTTGAGGCCAGG + Intronic
924455200 1:244213797-244213819 TGGGCAGGTCACTTGAGGCCAGG + Intergenic
924516306 1:244768897-244768919 TGGGCAAGTCCCCTGTGGCTAGG + Intergenic
924533099 1:244909920-244909942 TGGGCAAATCACTTGAGGCCAGG + Intergenic
1062818028 10:515493-515515 TGGGCCAATCACTTGAGGTAAGG + Intronic
1063712808 10:8495987-8496009 TGGGCAAGTCACTTGAGGTCAGG - Intergenic
1064188868 10:13187915-13187937 TGGGCCGATCACTTGAGGCCAGG + Intronic
1065504965 10:26421032-26421054 TGGGCAGGTCACTTGAGGCCAGG + Intergenic
1065731344 10:28712479-28712501 TGGGCAAATCACTTGTGCCCAGG - Intergenic
1066304701 10:34129378-34129400 TGGGCTAATCACTTGAGGCCAGG - Intronic
1066330323 10:34414586-34414608 TGGGCCAATCACTTGAGCCCAGG + Intronic
1067482442 10:46611951-46611973 TGGGCCTGTTTCTTGTGTCAGGG - Intergenic
1067612308 10:47729713-47729735 TGGGCCTGTTTCTTGTGTCAGGG + Intergenic
1067894012 10:50160415-50160437 TTGGCCTGTCACCTGTGCCAGGG - Intergenic
1067954836 10:50779849-50779871 TTGGCCTGTCACCTGTGCCAGGG + Intronic
1068448188 10:57150904-57150926 TGGGCAGGTCACTTGAGGCCAGG + Intergenic
1068949784 10:62765485-62765507 CGGGCCAATCACTTGAGGCCAGG - Intergenic
1069219881 10:65869817-65869839 GGGACCAGGCAATTGTGGCATGG + Intergenic
1070183142 10:74033833-74033855 TGACCCAGTCACTTGAGCCAGGG + Intronic
1070227443 10:74524618-74524640 TGGGCCAATCACTTGAGTCTAGG - Intronic
1070313814 10:75293050-75293072 TGGACCCATCAGTTGTGGCAAGG + Intergenic
1070621860 10:78018811-78018833 TGGGCAAATCACTTGAGGCCAGG - Intronic
1070704104 10:78625027-78625049 TGGGCCAGTCACCTGTGTCCAGG - Intergenic
1071519952 10:86323949-86323971 TGGGCGAGTCACTTGAGGTCAGG + Intronic
1071604835 10:86978553-86978575 TGGGCGGGTCACTTGAGGCCAGG + Intronic
1071627730 10:87189960-87189982 TGGGCCTGTTTCTTGTGTCAGGG + Intronic
1072420374 10:95286127-95286149 TGGGCAGGTCACTTGAGGCCAGG + Intronic
1073016640 10:100405366-100405388 TGGGCTAATCACTTGAGGCTGGG - Intergenic
1073887355 10:108055132-108055154 TGGGCAGGTCACTTGAGGCCAGG + Intergenic
1075136775 10:119793870-119793892 TGGGCTATTCACTTGAGGCCAGG - Intronic
1077413363 11:2413660-2413682 TGGGCCAGGCACCTGGGGGAAGG - Intronic
1077616545 11:3678892-3678914 TGGGCCGATCACTTGAGGCCAGG + Intronic
1077856748 11:6134030-6134052 TGGGAAAGTCACTTGAGCCAGGG + Intergenic
1078625969 11:12958434-12958456 TGGGCCAATCACTTGAGCCCAGG - Intergenic
1078776606 11:14399731-14399753 TGGGACAATCACTTGAGGCCAGG - Intergenic
1080090434 11:28341953-28341975 TGGGTCAGTCACCTGTAGCCAGG - Intergenic
1080545230 11:33310534-33310556 TGGGCGAATCACTTGAGGCCAGG - Intronic
1081584387 11:44374413-44374435 CCAGCCAGTCCCTTGTGGCAAGG + Intergenic
1081862433 11:46340919-46340941 CGGGCCAATCACTTGAGGCCAGG + Intronic
1081999104 11:47383268-47383290 TGGGCCAGTCACTGGTCTCTTGG - Intergenic
1082869464 11:57930841-57930863 TGGGCCAATCACTGGAGGCCAGG - Intergenic
1084512286 11:69613750-69613772 TGGCCCATTAACTTGGGGCAGGG - Intergenic
1085479923 11:76812944-76812966 TGGGCCAGTCACTTGAGGCCAGG + Intergenic
1085933685 11:81118246-81118268 ATGGCAAGTCACTTGTGACAGGG - Intergenic
1086030673 11:82351374-82351396 TGAGCCAAGCACTTGTGACAGGG + Intergenic
1086366764 11:86114810-86114832 TGGGCAGATCACTTGTGGCCAGG - Intergenic
1087437268 11:98136997-98137019 TGGGCCAATCACTTGAGGTCAGG - Intergenic
1087709165 11:101530015-101530037 TGGACCTGTCACTTTAGGCATGG - Intronic
1088165122 11:106926190-106926212 TGGGCGAATCACTTGAGGCCAGG + Intronic
1089061175 11:115627470-115627492 TGGGCCAGTGACTATTTGCAAGG + Intergenic
1089719011 11:120394828-120394850 TGGGCAGATCACTTGAGGCAAGG + Intronic
1089958589 11:122595867-122595889 AGGGACAGTCACTTGGGGCCAGG + Intergenic
1090089223 11:123679757-123679779 TGGGCGAATCACTTGAGGCCAGG + Intergenic
1091163065 11:133443879-133443901 TGGGAGAGTCACTTGAGGCCAGG + Intronic
1091530882 12:1354294-1354316 TGGGCCAATCACTTGAGGTCAGG + Intronic
1092247732 12:6872878-6872900 TGGGCCAGACAGCTCTGGCAGGG - Exonic
1092299952 12:7237989-7238011 TGGGCCAATCACTTGAGGTCAGG - Intergenic
1092497528 12:9011932-9011954 TGGGCCATTCCCCTGTGGCTAGG - Intergenic
1092589104 12:9934013-9934035 TGGGTCAGTTACATGTGGAAAGG - Intergenic
1093219474 12:16401596-16401618 TGGGGCTATCACTTGTGCCATGG - Intronic
1093918009 12:24827562-24827584 TGGGCAAATCACTTGAGGCTAGG + Intronic
1094228998 12:28081280-28081302 AGGGCCAGTAAATTGTGGAAAGG + Intergenic
1094700739 12:32868442-32868464 TGGGCAGATCACTTGAGGCAAGG - Intronic
1096915303 12:55025750-55025772 TGGACCAGCCAGTTGTGTCATGG + Intronic
1097049052 12:56209829-56209851 TGGGCAAGTCACTTCAGGCCAGG - Intronic
1097049383 12:56212502-56212524 TAGGCAAGTCACTTATGGAAAGG - Intronic
1097870535 12:64598144-64598166 TGGGCAAGTCACTTGAGGTCAGG - Intergenic
1098080796 12:66783259-66783281 TGGGCCAATCACATGAGGCCAGG - Intronic
1098917333 12:76271173-76271195 TGGGCAAATCACTTGAGGCCAGG + Intergenic
1099597271 12:84682949-84682971 TGGGCCAATCACTTGAGGTTGGG + Intergenic
1100550811 12:95644727-95644749 TGGGCCAATCACTTGAGGTCAGG + Intergenic
1101798969 12:108003892-108003914 TGGCCCAATCACCAGTGGCAGGG + Intergenic
1101891239 12:108717531-108717553 TGGGACTGTGACTTGTGGCCTGG - Intronic
1101950223 12:109168909-109168931 TGGGCGAATCACTTGAGGCCAGG + Intronic
1102081827 12:110104454-110104476 TGAGCCAATCACTGGTGGGAGGG - Intergenic
1102149987 12:110682424-110682446 TGGGCAAGTCACTTGAGGTCAGG - Intronic
1102308937 12:111828710-111828732 TGGGCCAGTCAGCTATGGCCAGG + Intergenic
1102765086 12:115425827-115425849 TGGGCAGGTCACTTGAGGCCAGG + Intergenic
1102891347 12:116560887-116560909 TGGGCAGGTCACTTGAGGCCAGG + Intergenic
1103473829 12:121203682-121203704 TGGTCCAGTCAGCTGTGGCCAGG + Intergenic
1103598378 12:122038202-122038224 TGGGCGGGTCACTTGAGGCCAGG + Intronic
1103750710 12:123158373-123158395 TGGGAGAATCACTTGTGGCCAGG + Intronic
1104416895 12:128603047-128603069 TGAGGCAGTCACTTGGGGCTGGG + Intronic
1105491281 13:20890878-20890900 TGGGCCAGTCACCTGAGGTCAGG + Intronic
1105941830 13:25154516-25154538 AGGCCCACTCACTTGTGTCAAGG + Intergenic
1106427813 13:29649543-29649565 TGGGCAAATCACTTGAGGTAAGG + Intergenic
1106514434 13:30440843-30440865 TGGGCAAATCACTTGAGGTAAGG + Intergenic
1106733144 13:32562510-32562532 TGGGCAAATCACTTGAGGTAAGG + Intergenic
1107337225 13:39368100-39368122 TGGGTCACTCACTTGAGGCCAGG + Intronic
1107485866 13:40827025-40827047 TGGGCAAATCACTTGAGGCCAGG - Intergenic
1107600054 13:42003989-42004011 TGGGCATATCACTTGAGGCAGGG + Intergenic
1107922444 13:45223162-45223184 TGGGCCAATCACTTGAGTCCAGG + Intronic
1108057931 13:46503633-46503655 TGGGCCAATCACTTGAGGTCAGG - Intergenic
1108801960 13:54108734-54108756 TGGGCGAATCACTTGAGGTAAGG - Intergenic
1109969227 13:69743555-69743577 TGGGCAAATCACTTGAGGCCAGG + Intronic
1111504358 13:89166774-89166796 TGGGCCAATCACTTGAGGTAAGG - Intergenic
1112268110 13:97944180-97944202 TGGGCAAATCACTTGAGGCCAGG - Intergenic
1113118527 13:106900860-106900882 TGGGCCAATCACTTGAGGTCAGG - Intergenic
1113124851 13:106965887-106965909 TGTGCCACTCACATTTGGCAGGG + Intergenic
1113241581 13:108344429-108344451 TGGGCGAGTCACTTGAGGTCAGG - Intergenic
1114300130 14:21368398-21368420 TGGGGCTATCACTTGTGCCATGG - Exonic
1115164315 14:30430690-30430712 TGGGCAGATCACTTGTGGCCAGG - Intergenic
1115650189 14:35397542-35397564 TGCCACAGTCACTTGGGGCATGG + Intergenic
1116315776 14:43390145-43390167 TGGGCAAATCACTTGAGGCCAGG - Intergenic
1116317331 14:43415257-43415279 TGGGCAAATCACTTGAGGCCAGG + Intergenic
1117435805 14:55714310-55714332 TGGGCCGATCACTTGAGGCCAGG - Intergenic
1118219564 14:63842377-63842399 TGGGCAAATCACTTGAGGCCAGG - Intergenic
1119066753 14:71535835-71535857 TGGGCAGGTCACTTGAGGCCAGG - Intronic
1119187509 14:72653222-72653244 TGGGACAATCACTTCTGACAAGG + Intronic
1119543672 14:75456823-75456845 TCGTCCAGTCAGCTGTGGCAGGG + Intronic
1119705444 14:76780053-76780075 TGGGCCAGTCACTTGTGGCAGGG + Exonic
1121757729 14:96417078-96417100 TGGGCCAGTCACAGGGAGCAAGG + Intronic
1121788446 14:96680587-96680609 TGGGCCAATCATTTGAGGCCAGG - Intergenic
1122013121 14:98770043-98770065 TGGGAGAATCACTTGAGGCAAGG - Intergenic
1122406079 14:101501907-101501929 TGGGCCAGGCACTTGGCACAGGG + Intergenic
1124209075 15:27747214-27747236 TGTGACAGTCACATGGGGCAAGG + Intergenic
1124270542 15:28276505-28276527 TGGGCCAGTCACTTTAGGTCAGG + Intronic
1124475039 15:30025833-30025855 TGGGGCAGACACTTGAGGGATGG + Intergenic
1125014593 15:34919667-34919689 TGGGTCAATCACTTGAGGCCAGG + Intronic
1125979333 15:43985591-43985613 TGGTCCAGTCAGTTGTGTAAGGG - Intronic
1126004961 15:44247508-44247530 TGGGCAAATCACTTGAGGCCAGG + Intergenic
1126157526 15:45579200-45579222 TGGGCAGATCACTTGAGGCAAGG - Intergenic
1127525676 15:59790373-59790395 TGGGCAGGTCACTTGAGGCCAGG + Intergenic
1127599313 15:60519300-60519322 TGTGTCATTCACTTGTGACAAGG + Intronic
1127893512 15:63275571-63275593 TGGGCAAGTCACTTGAGGCCAGG + Intergenic
1127966542 15:63926874-63926896 TTGGCCAGTCAGATGTGGCAAGG - Intronic
1128016380 15:64351649-64351671 CGGGCCAATCACTTGAGGCCAGG + Intronic
1129961225 15:79686935-79686957 GGGGGCAGTCAAGTGTGGCAAGG - Intergenic
1130074043 15:80673488-80673510 TGGGCCATTCGCTTGAGGCCAGG - Intergenic
1131374802 15:91914797-91914819 TGGGCAGGTCACTTGAGGCCAGG - Intronic
1132262059 15:100434305-100434327 TGGGCCTGTCACATGTGCCAAGG + Intronic
1133213470 16:4275979-4276001 TGGGCCACCCACTTGTGCCTAGG - Intergenic
1133759777 16:8789215-8789237 TGGGCCGATCACTTGAGGCCAGG + Intronic
1134088462 16:11375073-11375095 TGGGCGAATCACTTGAGGCCAGG - Intronic
1134584577 16:15398819-15398841 TGGGCAAGTCACTTGAGGTCAGG - Intronic
1134642286 16:15838630-15838652 TGGGCAAATCACTTGAGGCCAGG + Intronic
1134678706 16:16108823-16108845 CGGGCCAGTCACTTGAGCCCAGG - Intronic
1134792500 16:17001999-17002021 TGGGCAAATCACTTGAGGCCAGG - Intergenic
1135102083 16:19614636-19614658 TGGGCCAATCACTTGAGGTTAGG - Intronic
1135351739 16:21734909-21734931 TGGGCGAATCACTTGAGGCCAGG + Intronic
1135450224 16:22551033-22551055 TGGGCGAATCACTTGAGGCCAGG + Intergenic
1135576343 16:23588748-23588770 TGAGCCAATCACTTGAGGCCAGG + Intronic
1136102523 16:28006534-28006556 TGGGCAGATCACTTGAGGCAAGG - Intronic
1137642853 16:50048118-50048140 TGGGCAGATCACTTGTGGCCAGG + Intergenic
1138103037 16:54269627-54269649 TAGGGCACTCAGTTGTGGCAAGG + Intronic
1138186820 16:54983452-54983474 TGGGCTAGTGGCTTGTGGGAGGG - Intergenic
1138834016 16:60411363-60411385 TGGGCAAATCACTTGAGGCCAGG + Intergenic
1138911026 16:61399036-61399058 TGGGCCAGATAATTGTGGCTGGG + Intergenic
1139701042 16:68708098-68708120 CGGGCCGGTCACTTGAGGCCAGG + Intronic
1139888627 16:70230425-70230447 TGGGCGGATCACTTGTGGCCAGG + Intergenic
1140027441 16:71303451-71303473 TGGTCCAGTCAGCTGTGGCTGGG - Intergenic
1140053745 16:71506775-71506797 TGGGAGAGTCACTTGAGGCTAGG - Intronic
1141457996 16:84157293-84157315 TGGGCAGGTCACTTGAGGCCAGG + Intronic
1141469548 16:84229069-84229091 TGGGCAGATCACTTGAGGCAAGG + Intronic
1141695067 16:85615204-85615226 TGGGCCCCTCACCTGTGGCGTGG - Intronic
1142756138 17:2017503-2017525 TGAGCCAGTCAGTGGGGGCAGGG - Intronic
1142921619 17:3192562-3192584 TGGGAGAGTCACTTGAGGCCAGG + Intergenic
1143046502 17:4084883-4084905 TGGGCCAATCACTTGAGCCTTGG + Intronic
1143231258 17:5357596-5357618 TGGGCAAATCACTTGAGGCCAGG - Intronic
1143887450 17:10075869-10075891 TGGGCAAATCACTTGAGGCTAGG + Intronic
1144047243 17:11465095-11465117 TGGGACAGTCAGTTGAGGCCAGG - Intronic
1144157987 17:12526635-12526657 AGGGCCAATCACTTGAGGCCAGG - Intergenic
1144858834 17:18287009-18287031 TGGGCCAATCACTTGAGGTCAGG - Intronic
1145244755 17:21261257-21261279 TGGGCCAATCACTTGAGGCCAGG + Intergenic
1146113237 17:30110932-30110954 GGGGCCAATCACTTGAGGCCAGG - Intergenic
1146126320 17:30234377-30234399 TGAGCAAGCCACTTGGGGCATGG - Intronic
1146190685 17:30762951-30762973 TGGGCGAATCACTTGAGGCCAGG - Intergenic
1146248389 17:31312280-31312302 TGGGCCAATCACTTGAGGTCAGG + Intronic
1146747932 17:35348340-35348362 TGGGCAGGTCACTTGAGGCTAGG - Intergenic
1146838339 17:36130950-36130972 TGGGCCAATCACTTGAGGCCAGG + Intergenic
1147395995 17:40143216-40143238 TGGGCCAGTCACTTGAGGCTAGG + Intronic
1147748477 17:42711106-42711128 TGGGCCAATCACTTGAGGTCAGG + Intronic
1148121304 17:45213681-45213703 TGGGAAAGTCACTTGAGCCAGGG - Intergenic
1148529083 17:48372197-48372219 TGGGTAAATCACTTGAGGCAAGG - Intronic
1148692308 17:49536250-49536272 TGGGCGAATCACTTGAGGCCAGG + Intergenic
1148915981 17:50979144-50979166 TGGGCCAATCACTTGAGCCCAGG + Intronic
1148944831 17:51251990-51252012 TGGGCCAATCACTTGAGGCCAGG - Intronic
1149608197 17:57939691-57939713 TGGGCCAGTCAGCTGGGGCCAGG - Intronic
1149812733 17:59693137-59693159 TGGGCTGATCACTTGTGGCCAGG + Intronic
1149828780 17:59853077-59853099 TGGGCAGATCACTTGAGGCAAGG - Intergenic
1150496392 17:65611180-65611202 TGGGCCAGTGATCTGTGGCCTGG - Intronic
1150498424 17:65627133-65627155 TGGGCGGGTCACTTGAGGCCAGG - Intronic
1150677383 17:67256367-67256389 TGGGCCAATCACTTGAGGCCAGG + Intergenic
1150776607 17:68086637-68086659 TGGGCCGATCACTTGAGGCCAGG - Intergenic
1151252473 17:72847173-72847195 TGGGCTAATCACTTGAGGCCGGG + Intronic
1151369136 17:73636458-73636480 TGGGCGAGTCACTTGAGGTCAGG + Intronic
1151657215 17:75501739-75501761 TGGGAGAGTCACTGCTGGCAGGG - Intronic
1152039886 17:77896121-77896143 TGGGCGGATCACTTGAGGCAAGG - Intergenic
1152161808 17:78673496-78673518 TGGGGCAGTCACCTGGGGAATGG + Intergenic
1152416047 17:80162697-80162719 TGGGCGAATCACTTGAGGCCAGG + Intergenic
1153034943 18:752713-752735 TGGGCAAATCACTTGAGGCCAGG + Intronic
1155005709 18:21727358-21727380 TGGGCGGATCACTTGAGGCAAGG - Intronic
1155103852 18:22641191-22641213 TGGGCAAATCACTTGAGGCCAGG + Intergenic
1155234674 18:23807247-23807269 TGGGACAGTCACTTGAGGCCAGG + Intronic
1156559163 18:38102618-38102640 TGGGCAGGTCACTTGAGGCCAGG - Intergenic
1157356571 18:46940794-46940816 TGGGACAATCACTTGAGGCCAGG + Intronic
1158461028 18:57645814-57645836 TGGGCGGGTCACTTGAGGCCAGG - Intergenic
1158610826 18:58939017-58939039 TGGGCGAATCACTTGAGGCTAGG + Intronic
1159044341 18:63354438-63354460 TGGGCCAGTCACCTGAGGTCAGG + Intronic
1161336921 19:3719506-3719528 TGGGCTAATCACTTGAGGCCAGG + Intronic
1161567830 19:5013258-5013280 AGAGACAGTTACTTGTGGCAGGG + Intronic
1161860971 19:6798047-6798069 TGGGCAAATCACTTGAGGCCAGG + Intronic
1161863159 19:6813824-6813846 TGGGAGAGTCACTTGAGGCCAGG + Intronic
1161969804 19:7571595-7571617 TGGGCCAGCCACTTGAGCCCAGG - Intergenic
1162204253 19:9043985-9044007 TGGGCCAATCACTTGAGGTCAGG - Intergenic
1162256611 19:9495476-9495498 TGGGCCAATCACTTGATGCCAGG + Intronic
1162503610 19:11069068-11069090 TGGGCGGATCACTTGAGGCAAGG + Intergenic
1163205536 19:15799929-15799951 TGGGCAGGTCACTTGAGGCCAGG - Intergenic
1163808388 19:19414760-19414782 TGGGCAAATCACTTGAGGCCAGG - Intronic
1164640612 19:29822714-29822736 TGGGCCGATCACTTGAGGCCAGG + Intronic
1165010551 19:32843227-32843249 TGGGCAAATCACTTGAGGCCAGG + Intronic
1165127701 19:33612329-33612351 TGGGACAATCACTTGAGGCCAGG - Intergenic
1165132237 19:33640243-33640265 TGGCCCAGTTCCTTGTGGCAAGG - Intronic
1165468476 19:35989368-35989390 TGGGCGGGTCACTTGAGGCCAGG - Intergenic
1165483207 19:36078373-36078395 TGGGCAAATCACTTGAGGCGAGG - Intronic
1165557253 19:36644822-36644844 TGGGCAAATCACTTGAGGCCAGG - Intronic
1165756301 19:38295156-38295178 TGGGCCAATCACTTGAGGTCAGG + Intronic
1165759864 19:38314838-38314860 TGGGCGAATCACTTGGGGCCAGG - Intronic
1166077700 19:40423268-40423290 TGGGCTAGGCACAGGTGGCAGGG + Exonic
1166867799 19:45851346-45851368 TGGGCCAATCACTTGAGGTCAGG + Intronic
1167684015 19:50944232-50944254 TGGGCGAATCACTTGAGGCCAGG - Intronic
1168001475 19:53449779-53449801 TGGGACAATCACTTGAGCCAAGG - Intronic
1168551624 19:57301152-57301174 TGGGCGAGTCACTTGAGGTCAGG - Intergenic
1168570406 19:57463035-57463057 TGGGCAGGTCACCTGTGGCCAGG + Intronic
925977923 2:9153983-9154005 TGGGCTAGTATCTTGCGGCAGGG + Intergenic
926041174 2:9674430-9674452 TGGGCCAGTCATCTGTGACCAGG + Intergenic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
926184704 2:10680045-10680067 TGGGCGGATCACTTGAGGCAAGG + Intronic
927588126 2:24328688-24328710 TGGGCAGGTCACTTGAGGCCAGG - Intronic
927595070 2:24389155-24389177 TGGGCCGATCACTTGAGGCCAGG - Intergenic
927763812 2:25785450-25785472 TGGGCCAATCACTTGAGGTCAGG - Intronic
928450408 2:31373291-31373313 GGGGGCAGTAAATTGTGGCATGG + Intronic
929222834 2:39482910-39482932 TGGGAAAGTCACTTGAGGCCAGG - Intergenic
929562909 2:42966880-42966902 TGGGCCAATCACTTGAGGTCAGG + Intergenic
929601115 2:43205341-43205363 CGGGCGAGTCACTTGAGGCCAGG - Intergenic
930129424 2:47834120-47834142 TGGGCAAATCACTTGAGGCCAGG + Intronic
933111339 2:78405261-78405283 TGGGCCAGTTATTTTTGGCTTGG + Intergenic
934102491 2:88666451-88666473 TAGGCGAGTCACTTGAGGCCAGG - Intergenic
935966088 2:108477816-108477838 TGGGTGAGTCACTTGAGGCCAGG + Intronic
936371507 2:111905694-111905716 TGGGCCAATCACCTGAGGCCAGG - Intronic
936473318 2:112817829-112817851 TGGGAGAGTCACTTGAGGCCAGG + Intergenic
936520205 2:113207192-113207214 TGAGCCAGTCACTAGAGCCAGGG + Intronic
937831015 2:126423474-126423496 TGGGAAAGTCACTTGAGGCCAGG + Intergenic
937976405 2:127584612-127584634 GGGGTCAGTGACTTGTTGCAGGG - Intronic
938014047 2:127852471-127852493 TGGACCAGTCTCTTGAGGCCAGG - Intronic
940956531 2:159734742-159734764 TGGGAGGGTCACTTGTGGCCAGG + Intronic
941944578 2:171080798-171080820 TGGGACAGTAACTTGAGCCAAGG - Intronic
942288386 2:174444721-174444743 TGGGCAGGTCACTTGAGGCCAGG - Intronic
942362117 2:175183184-175183206 TGGACTAGTTGCTTGTGGCAGGG + Exonic
943495708 2:188618679-188618701 TAGGCCAGTCACTTTTGCCCAGG - Intergenic
943644236 2:190391444-190391466 TGGTCCAGTCAGTAGTGACAAGG + Intergenic
944309876 2:198221800-198221822 TGGGCCGATCACTTGTGGTCAGG + Intronic
944555770 2:200886651-200886673 TGGGCCAATCACTTGAGGTCAGG - Intronic
944612140 2:201421819-201421841 TGGGCCGATCACTTGAGGTAAGG + Intronic
944708122 2:202311386-202311408 TGGGCCAGGCACTTGTGAGCAGG + Intergenic
944841291 2:203626197-203626219 TGGGCGGATCACTTGAGGCAAGG + Intergenic
945141553 2:206692045-206692067 TGGGAAAGTCACTTGAGGCCAGG + Intronic
947423542 2:229961951-229961973 TGGGCCAATCACATGAGGCCAGG + Intronic
947659584 2:231856520-231856542 TGGGAGGGTCACTTGAGGCAAGG - Intergenic
947862846 2:233374560-233374582 TGGGCAAATCACTTGTGCCCAGG - Intronic
948973898 2:241450730-241450752 TGGGCCAATCACTTGAGGCTAGG + Intronic
1168817167 20:746632-746654 CAGGCCAGTCACTTGGGGCCAGG + Intergenic
1168874186 20:1159386-1159408 TGGGCAAATCACTTGAGGCCAGG - Intronic
1169459240 20:5780204-5780226 TGGGCAAATCACTTGAGGCCAGG - Intronic
1169885306 20:10392067-10392089 TGGGCAGATCACTTGTGGCTGGG + Intergenic
1170141504 20:13129227-13129249 TGGGCAAATCACTTGAGGCCAGG - Intronic
1170306010 20:14938551-14938573 TGGGCCAATCACTTGAGGCCAGG + Intronic
1170607867 20:17887323-17887345 TGGGCGGATCACTTGTGGCCAGG - Intergenic
1170960797 20:21023894-21023916 TGGATCAGTCACCTGTGGCTGGG - Intergenic
1172371260 20:34394002-34394024 TGGGCGGGTCACTTGAGGCCAGG + Intronic
1172679193 20:36699173-36699195 TGGGACAATCACTTGAGGCCAGG - Intronic
1172833240 20:37854814-37854836 TGGGCGAATCACTTGAGGCCAGG - Intronic
1175353838 20:58346362-58346384 TGGGCAAGTCACGTGGGGCTTGG - Intronic
1176184177 20:63769190-63769212 TGGGCCAAACACTTGGGGCATGG - Intronic
1177488226 21:21786786-21786808 TGGGCAAATCACTTGAGGCCAGG - Intergenic
1177673420 21:24264754-24264776 TGTTCCAGTCACTTGAGGCCAGG - Intergenic
1178043564 21:28669129-28669151 TGGGCCAATCACTTGAGGTCAGG + Intergenic
1178857387 21:36261678-36261700 TGGGTGAGTCACTTGAGGCCAGG + Intronic
1180685424 22:17662592-17662614 TGGGCCAATCACTTGAGCCCAGG + Intronic
1180841112 22:18959376-18959398 TGGGCCAGCCACTTGGGGCCCGG - Intergenic
1180959847 22:19757569-19757591 TGGGCCAGTCGGTGGGGGCATGG - Intronic
1181060386 22:20279418-20279440 TGGGCCAGCCACTTGGGGCCGGG + Intronic
1181424831 22:22827984-22828006 TGGGCCAATCACTTGAGGTCAGG + Intronic
1183006659 22:34908609-34908631 TGGGCCAGGCAATGGCGGCAGGG + Intergenic
1183578953 22:38711612-38711634 TGGGCCAATCACTTGAGGCCAGG + Intronic
1183655929 22:39184730-39184752 TGGGTGAGTCACTTGTCTCAGGG - Intergenic
1183931910 22:41240316-41240338 TGGGACAATCACTTGAGGCCAGG - Intronic
1184080313 22:42214706-42214728 TTGGCCAGTGGCCTGTGGCAGGG + Exonic
1184267579 22:43357525-43357547 TGGGGCAGGCACTGGAGGCACGG + Intergenic
1184291993 22:43502365-43502387 TGGGCCAGGCACTTGGGGTGGGG - Intronic
1184452997 22:44593935-44593957 GGATCCAGTCACTTGTGGCCGGG + Intergenic
949328226 3:2891234-2891256 TGGGTGAGTCACTTGAGGCCAGG + Intronic
949531083 3:4955881-4955903 TGGGCCAATCACTTGAGGTCAGG + Intergenic
949723194 3:7014541-7014563 TGGGCAAATCACTTGAGGCCAGG - Intronic
950531917 3:13557144-13557166 TGGGCCAGTCAGCTGTGGCTGGG + Intronic
950636805 3:14321262-14321284 TGGGCCACCCACTGTTGGCATGG + Intergenic
952265749 3:31784808-31784830 TGGGCGAATCACTTGGGGCTAGG - Intronic
952348341 3:32509741-32509763 TGGGCCAATGACTTGAGGCTAGG + Intergenic
952400327 3:32957389-32957411 TGGGCCGGTCACTTGAGGTCAGG + Intergenic
952910205 3:38178176-38178198 TGGGCAGGTCACTTGAGCCAAGG - Intronic
953064682 3:39458085-39458107 TGGGCGAGTCACTTGAGGTCAGG + Intergenic
953691372 3:45122679-45122701 TGGGCAAATCACTTGAGGCCAGG - Intronic
954281579 3:49583194-49583216 TGGGCAAATCACTTGAGGCCAGG - Intronic
954560813 3:51555068-51555090 TGGGCGGGTCACTTGAGGCCAGG - Intronic
955121652 3:56065701-56065723 AGGGCCAGTCAGTAGGGGCAGGG - Intronic
955195142 3:56798686-56798708 TAGACCAGTCCCTTTTGGCATGG + Intronic
955289320 3:57676148-57676170 TGGGCAGGTCACTTGAGGCCAGG + Intronic
955384681 3:58470107-58470129 AGGGGCAGTAACTTGTGGGAAGG + Intergenic
955676254 3:61451995-61452017 TGGGCCAGTCACTTGAGGTCAGG - Intergenic
955798199 3:62659713-62659735 TGGACCAATCACGTGTGGCCAGG + Intronic
955849696 3:63206383-63206405 TGGGCAGGTCACTTGTGGTGAGG + Intergenic
956123510 3:65989763-65989785 TGGGCGGGTCACTTGAGGCCAGG - Intronic
956423556 3:69110155-69110177 TGGGAGAATCACTTGTGGCCAGG + Intronic
956865235 3:73362887-73362909 TGGGCTGGTCACTTGAGGCCAGG + Intergenic
959039144 3:101400865-101400887 TGGGACAATCACTTGAGGCCAGG + Intronic
959106830 3:102074348-102074370 TAAGCCAGTCACAAGTGGCATGG + Intergenic
959609788 3:108280386-108280408 TGGGCCTCTACCTTGTGGCAGGG + Intergenic
960738141 3:120803100-120803122 TGGGCGAGTCACTTGGGGTCAGG - Intergenic
961262189 3:125611097-125611119 TGGGCAAATCACTTGAGGCCAGG - Intergenic
962678908 3:137778553-137778575 TGGGTAAGTCACTAGTGTCAAGG + Intergenic
962794646 3:138839718-138839740 TGATCCAGTCACATGTGCCAAGG + Intergenic
963133944 3:141883258-141883280 TGGGCGGATCACTTGTGGCCAGG + Intronic
963286459 3:143438780-143438802 TGGGCCAGTCACTGGTAACTCGG - Intronic
964484904 3:157177265-157177287 CGGGCAAATCACTTGAGGCAAGG - Intergenic
964970522 3:162554002-162554024 TGGTCCAGTGTCTTCTGGCAAGG - Intergenic
965914997 3:173833610-173833632 TGGGAGAGTCACTTGTGGCCTGG - Intronic
966197756 3:177330350-177330372 TGGGAGAGTCACTTGAAGCAGGG - Intergenic
966602017 3:181785295-181785317 TGGGCATGTCTGTTGTGGCATGG + Intergenic
967049698 3:185771210-185771232 TGGGCCGATCACTTGAGGCCAGG + Intronic
967984606 3:195085698-195085720 TGGGCCAGCCCCTGGTGGAATGG - Intronic
968262346 3:197335430-197335452 GTGGCCAGACACTTGTGGCCTGG + Intergenic
968583350 4:1404935-1404957 TGGGCCAGGCACCCGGGGCAGGG - Intronic
969738451 4:9006635-9006657 TGGGCCGGTCACTTGAGGTCAGG - Intergenic
969910303 4:10438565-10438587 TGGGCCAGTCACCTGAGGTTGGG + Intergenic
971239420 4:24874351-24874373 TGGGCAGGTCACTTGAGGCCAGG + Intronic
971324767 4:25634815-25634837 TGGGCCAATCAGTTGAGGCCGGG + Intergenic
972163070 4:36248688-36248710 TGGGCGAATCACTTGAGGCCAGG - Intergenic
972446982 4:39153771-39153793 TGGGCAGGTCACTTGAGGCCAGG - Intergenic
972631996 4:40850201-40850223 TGGGCAAATCACTTGAGTCAAGG - Intronic
972645961 4:40967658-40967680 TGAGCCAGACACGAGTGGCAAGG - Intronic
975161143 4:71125343-71125365 GGGGCAAGTCACTTGAGGCCAGG + Intergenic
975861280 4:78679711-78679733 TGGGAGAGTCACTTGAGGCCAGG + Intergenic
975962887 4:79934299-79934321 TGGGCAAATCACTTGAGGCCAGG + Intronic
976482258 4:85558129-85558151 TGGGCCAGTCACTGTTGCTAGGG + Intronic
977084554 4:92576660-92576682 TGTGTCAGACACTGGTGGCATGG + Intronic
977116500 4:93035339-93035361 AGGGCCTGTCACTTGAGCCAAGG - Intronic
979866364 4:125759722-125759744 TGAGCCTGTCACTAGTGGAAAGG - Intergenic
980517141 4:133878015-133878037 TGGGGCAGTCACTTGGCACAGGG - Intergenic
980965028 4:139512984-139513006 TGGGCCAATCACTTGAGGCCAGG - Intronic
981284950 4:143005760-143005782 TGGGCCAGTCAGTTGTGGTAGGG - Intergenic
981301680 4:143193856-143193878 TGGGCAAATCACTTGAGGCCAGG + Intronic
983111685 4:163758170-163758192 TGGGCCAGTCACTTGGCTGAGGG + Intronic
984707644 4:182859435-182859457 TGGGCGAATCACTTGAGGCCAGG + Intergenic
985335170 4:188884694-188884716 TGGGCAAATCACTTGAGGCCAGG + Intergenic
985672056 5:1212181-1212203 TGGGCGTGTCACTGGTGTCAAGG + Intronic
985922437 5:2988577-2988599 TGCCCCAGTCAATTGTGGGATGG + Intergenic
985928027 5:3033214-3033236 TGGGCCAGGCATGTGTGGAATGG - Intergenic
986471342 5:8080198-8080220 AGGGCGAGTCACTTGTGGAAGGG - Intergenic
986586171 5:9320480-9320502 TGGGCCAATCACTTGAGTCCTGG + Intronic
987040930 5:14061491-14061513 CGGGCCAATCACTTGAGGCCAGG + Intergenic
987111158 5:14688309-14688331 AGGGCCTGTCACTTGCGCCAGGG + Intronic
988317820 5:29653661-29653683 TGGGCCAGTCACCTGAGGTCAGG + Intergenic
988476093 5:31587410-31587432 TGGGCGAGTCACTTGAGGCCAGG - Intergenic
988518765 5:31927710-31927732 AGGGCCAGTCACTTCGGGCAAGG - Intronic
988534606 5:32055422-32055444 TGGGACATTCACTTGAGGCCAGG - Intronic
988779487 5:34506907-34506929 TGGGCGAATCACTTGAGGCCAGG - Intergenic
989679517 5:44012640-44012662 TGGGCCAATGTCTTGAGGCAGGG + Intergenic
991685744 5:69180849-69180871 TGGGAGAGTCACTTGAGGCCAGG - Intergenic
991726811 5:69543741-69543763 TGGGCGAATCACTTGAGGCCAGG - Intronic
991868146 5:71084133-71084155 TGGGCGAATCACTTGAGGCCAGG + Intergenic
991914465 5:71592151-71592173 TGGGCAAATCACTTGAGGTAAGG + Intronic
992563428 5:77974262-77974284 TGGGCCGATCACTTGAGGCTAGG - Intergenic
992681303 5:79156090-79156112 TGGGCAAATCACTTGTGGTCAGG + Intronic
994848821 5:105026179-105026201 TGGGCCGATCACTTGAGGCCAGG + Intergenic
995111516 5:108434210-108434232 TGGGAGAATCACTTGAGGCAAGG - Intergenic
995453401 5:112327486-112327508 TGGGAGAATCACTTGAGGCAAGG + Intronic
995584243 5:113630428-113630450 TGGGCAGGTCACTTGAGGCTAGG + Intergenic
995728957 5:115215523-115215545 TGGGCGGATCACTTGAGGCAAGG - Intronic
996384437 5:122895919-122895941 TGGGCAAATCACTTGAGGCCAGG + Intronic
996396675 5:123020929-123020951 TGAGCCAGTCACTGGAGCCAGGG + Intronic
998000734 5:138623018-138623040 TGGGCCAATCACTTGAGGTCAGG - Intronic
998570864 5:143255740-143255762 TGGGCTGGTCACTTGAGGCCAGG + Intergenic
998802915 5:145888944-145888966 TGGGCAGGTCACTTGAGGCCAGG + Intergenic
998807223 5:145930310-145930332 TGGGCGAATCACTTGAGGCCGGG - Intergenic
999404831 5:151297733-151297755 TGGGCCAGTCACCTGAGGTCAGG + Intronic
1000110561 5:158104392-158104414 AGGGCCAGTCACTTGAGGTCGGG - Intergenic
1001056819 5:168456403-168456425 TGGGCAAATCACTTGAGGCCAGG + Intronic
1001277912 5:170364231-170364253 TGGGCCAATCACTTGAGCCTAGG - Intronic
1001441458 5:171746819-171746841 TGGTCCAGTCAGCTGTGGCCGGG - Intergenic
1001532126 5:172470752-172470774 TGGGCGAATCACTTGAGGCCAGG - Intergenic
1001583730 5:172818592-172818614 TGGGCCAATCACTTGAGGCCAGG - Intergenic
1002062255 5:176632481-176632503 TGGGCCGATCACTTGTGGTCAGG - Intronic
1002479381 5:179489712-179489734 TGAGACAGTCACTTGAGGCTAGG + Intergenic
1002603228 5:180366900-180366922 TGGGACAATCACTTGAGGCCAGG - Intergenic
1004235027 6:13867776-13867798 TGGGCCAATCACTTGAGGCCAGG - Intergenic
1006830779 6:36967007-36967029 TTGGCCAGTCACCTCTGGGAGGG - Intergenic
1006879781 6:37328952-37328974 TGGGCCAATCACTTGAGGTAAGG - Intronic
1007099822 6:39238365-39238387 TGGGCCAATCACTTGAGGTCAGG - Intergenic
1007643491 6:43362729-43362751 TGGGCCAATCACTTGAGGTCAGG - Intronic
1007806747 6:44455999-44456021 TGGGCAGGTCACTTGAGGCGAGG + Intergenic
1008136613 6:47784523-47784545 TGGGCAAATCACTTGAGGCCAGG - Intronic
1008666631 6:53723174-53723196 TGGGCCAGTCACCTGAGGTCAGG + Intergenic
1008877028 6:56340359-56340381 TGGGGCAGGGACTTGGGGCAAGG + Intronic
1008922014 6:56851889-56851911 TGGGCCAGTCATTTGTGAGCTGG - Intronic
1010835532 6:80583175-80583197 TGGGCGAATCACTTGAGGCCAGG + Intergenic
1011101893 6:83731489-83731511 TGGGCCCTGCCCTTGTGGCACGG + Intergenic
1011278256 6:85650850-85650872 TGGTCCAATTAGTTGTGGCAAGG - Intergenic
1011575520 6:88793635-88793657 TGGGCAAATCACTTGAGGCCAGG + Intronic
1011873804 6:91930678-91930700 TGAGCCAGTCAGTTGTGCCTTGG - Intergenic
1012278142 6:97298074-97298096 TGGGCAGATCACTTGAGGCAAGG + Intergenic
1013096904 6:106953384-106953406 TGGGCAAATCACTTGAGGCCAGG + Intergenic
1013506724 6:110807685-110807707 TGGGCAGATCACTTGAGGCAAGG - Intronic
1014449043 6:121562333-121562355 TGGGCCAATCACTTGAGGCCAGG + Intergenic
1015273873 6:131364827-131364849 TGGGCCGGTCACTTGAGGTCAGG + Intergenic
1015518649 6:134110169-134110191 TGGGCCAGTCACCTGAGGTCAGG + Intergenic
1015964868 6:138688177-138688199 TGGGCCGATCACTTGAGGCCAGG - Intronic
1016804382 6:148198075-148198097 TGGGCCAATCACTTGAGGTTAGG - Intergenic
1017064246 6:150514566-150514588 TGGGCCAATCACTTGAGGTTAGG - Intergenic
1017765281 6:157602277-157602299 TGGGCCAGTCACTTGAGGTCAGG + Intronic
1017908919 6:158776245-158776267 TGGGCCAGGCAATTGCTGCAGGG - Intronic
1019509730 7:1411898-1411920 TGGGGAAGTCACGTGTGGAAAGG + Intergenic
1019881778 7:3867515-3867537 GGGGCCAGTCACTTCTTACATGG + Intronic
1021730583 7:23591716-23591738 TGGGCAAATCACTTGAGGCCGGG - Intergenic
1022500285 7:30878408-30878430 CGGACCAGTTACTTATGGCAGGG - Intronic
1023424690 7:40023290-40023312 TGGGCAAATCACTTGAGGCCAGG - Intronic
1023816503 7:43954493-43954515 TGGGCGGGTCACTTGAGGCCAGG - Exonic
1024037904 7:45524130-45524152 TGTGCCAGTTGCTTTTGGCAGGG - Intergenic
1025055546 7:55761835-55761857 TTGGCCAGGCAGTAGTGGCATGG + Intergenic
1025943926 7:66092222-66092244 TGGGCGGGTCACTTGAGGCCAGG + Intronic
1026257374 7:68724193-68724215 TGGGCCAATCACTTGAGGTCAGG + Intergenic
1026569054 7:71513611-71513633 TGGGCGAATCACTTGAGGCCAGG - Intronic
1026831566 7:73613369-73613391 TGGGCAGATCACTTGTGGCCAGG + Intronic
1028506529 7:91577174-91577196 TGGGCCAGTCAATTGTGCTGTGG + Intergenic
1028562719 7:92193233-92193255 TGGGCAGATCACTTGAGGCAAGG + Intergenic
1029680952 7:102108979-102109001 TGGGCAGGTCACTTGTGGTCAGG - Intronic
1029956130 7:104642263-104642285 TGGGCGGATCACTTGAGGCAAGG - Intronic
1030118710 7:106084753-106084775 TGGGCAGGTCACTTGAGGCCAGG + Intergenic
1030418184 7:109271764-109271786 TGGGCCTGTTACTTGAGGCATGG + Intergenic
1030424372 7:109355013-109355035 TGGGCAACTCACTTGAGGCCAGG - Intergenic
1030658271 7:112191751-112191773 AGGGCCAGTAATTTGTTGCAGGG - Intronic
1031613058 7:123849527-123849549 TGGTCCAATCACTTGAGGCCAGG - Intronic
1032739940 7:134729077-134729099 TGGGCAGGTCACTTGAGGCCAGG - Intergenic
1033267786 7:139900906-139900928 TGGACCAGTCACTGTTGCCAAGG + Intronic
1034285984 7:149883248-149883270 TGGTCCAGTCTCTTGGTGCAGGG + Intergenic
1034447020 7:151118925-151118947 TGGGCCATCCACAGGTGGCATGG + Intronic
1034699046 7:153080882-153080904 TGTGCCAGGCCCTTGTGACAGGG + Intergenic
1036251339 8:7165519-7165541 TGGGCGAATCACTTGAGGCCAGG - Intergenic
1036366150 8:8121941-8121963 TGGGCGAATCACTTGAGGCCAGG + Intergenic
1036448408 8:8843354-8843376 TGGGCAAATCACTTGAGGCCAGG + Intronic
1036456573 8:8914327-8914349 TGGGTGAGTCACTTCAGGCAAGG + Intergenic
1036640132 8:10578109-10578131 TGGGCGGGTCACTTGAGGCCAGG + Intergenic
1037548472 8:19947275-19947297 TGGGCAAATCACTTGAGGCCAGG + Intronic
1037954170 8:23041282-23041304 TGGGCAAATCACTTGAGGCCAGG - Intronic
1038755008 8:30332568-30332590 TGGGCAAATCACTTGAGGCCAGG - Intergenic
1039241204 8:35558753-35558775 TGGGCGGGTCACTTGAGGCCTGG + Intronic
1040665679 8:49629880-49629902 TGTGCCAGTCCCTGGTGGCAGGG + Intergenic
1041676423 8:60544621-60544643 TGGGAGAATCACTTGAGGCAAGG - Intronic
1041922674 8:63200228-63200250 TGGGAAAGTCCCATGTGGCAAGG - Intronic
1042451431 8:68951748-68951770 TGGGCGAATCACTTGAGGCCAGG + Intergenic
1043015296 8:74932416-74932438 TGGGCGAGTCACTTAAGGTAAGG - Intergenic
1043742373 8:83830069-83830091 TGGGCGAGTCACTTGAGTCCAGG - Intergenic
1043967344 8:86494326-86494348 TGGGCAGATCACTTGAGGCAAGG + Intronic
1044231876 8:89788112-89788134 TGGGCAAATCACTTGAGGCCAGG + Intronic
1044905023 8:96991327-96991349 TGGGCCAATCACTCGAGGCCAGG + Intronic
1045385792 8:101669972-101669994 TTGGCCAGTCCCTTTGGGCAGGG + Intergenic
1045599081 8:103693068-103693090 TGGGCAATTCACTTCTGGCTAGG + Intronic
1045771227 8:105742662-105742684 TGGGCCAGTCACCTGAGGTTAGG + Intronic
1046442179 8:114271536-114271558 TGGGCAAATCACTTGAGGCCAGG + Intergenic
1046631964 8:116630162-116630184 TGGGCATGTCACTTGAGGCCAGG + Intergenic
1047253337 8:123197089-123197111 TGAGCCAGTTACCTGTGGCTGGG + Intronic
1047766217 8:127992156-127992178 TGGGCTAATCACTTGAGGCCAGG + Intergenic
1048094276 8:131274450-131274472 AGATCCAGTCACTAGTGGCAGGG + Intergenic
1048392435 8:133980416-133980438 TTGGCCAGTGACTACTGGCAGGG - Intergenic
1048509264 8:135047560-135047582 TGAGCCAATCACTTGAGGCCAGG - Intergenic
1048688936 8:136936921-136936943 TGGGCAGGTCACTTGAGGCCAGG + Intergenic
1048946069 8:139448662-139448684 TGGGCAGGTCACTTGAGGCCAGG + Intergenic
1049015879 8:139919762-139919784 TGGGCCACACACTGGTAGCATGG - Intronic
1049372177 8:142273138-142273160 TGGGCCAGCCACCTGTGCCATGG - Intronic
1049584884 8:143428422-143428444 TGGGCCAGAGCCTTCTGGCATGG - Exonic
1050562474 9:6848437-6848459 TGGGCAGGTCACTTGAGGCCAGG + Intronic
1051906999 9:22106617-22106639 TGTGCCAGTCCCTTATGCCAAGG - Intergenic
1052862781 9:33447148-33447170 TGGCTGAGTCACTTGTGGGAGGG + Intronic
1052869210 9:33486830-33486852 TGGGCCAATCACTTGAGGTCAGG - Intergenic
1054800729 9:69345829-69345851 TGGGCAAGTCACTTGAGGTCAGG - Intronic
1056131668 9:83593235-83593257 TGGGCAAATCACTTGAGGCCAGG - Intergenic
1057872496 9:98728903-98728925 TGGGACAGACACCTGTGGAAGGG + Intergenic
1058172705 9:101702072-101702094 TGGGCGAATCACTTGAGGCCAGG + Intronic
1059475443 9:114543113-114543135 TGGGCGGATCACTTGAGGCAAGG + Intergenic
1059751604 9:117253097-117253119 TTGGGCAGTCATTGGTGGCAAGG + Intronic
1060123370 9:121018023-121018045 TGGGCCGATCACTTGAGGCCAGG + Intronic
1060293984 9:122330700-122330722 TGGGCGAGTCACTTGAGGTCAGG + Intergenic
1060475560 9:123984047-123984069 AGGGCCAGCCACTTGTCACACGG - Intergenic
1060981713 9:127796315-127796337 TGGGTCAGTCGCTTGAGGCCAGG - Intronic
1061137980 9:128746966-128746988 TGGGCAGGTCACTTGAGGCTAGG + Intronic
1061687052 9:132289979-132290001 TGGGCAAATCACTTGAGGTAAGG + Intronic
1061698954 9:132400548-132400570 TGGGTGAGTCACTTGAGGCCAGG - Intronic
1062328671 9:136025684-136025706 TGGGCCAGTCACTTGAGGTTAGG + Intronic
1185844093 X:3420801-3420823 TGGGCGAATCACTTGAGGCCAGG + Intergenic
1187334630 X:18371459-18371481 TGGGCGAATCACTTGAGGCCAGG + Intergenic
1187404882 X:18994260-18994282 TGGGCAAATCACTTGTGGTCAGG + Intronic
1187465363 X:19521903-19521925 TGGGCAGGTCACTTGAGGCCAGG - Intergenic
1188443846 X:30236491-30236513 TGGGACAGTGACTCGTGGGAGGG + Exonic
1189488481 X:41451048-41451070 TGAGCCTGTCACTTGAGGCCAGG - Intronic
1190379273 X:49823086-49823108 TGGGCAAATCACTTGAGGCCAGG - Intergenic
1191054477 X:56228031-56228053 TGGGCCAGAAACATGTGGCCAGG - Intergenic
1191723898 X:64258860-64258882 TGGGATAAGCACTTGTGGCAGGG + Intergenic
1191870410 X:65740595-65740617 TTGGCCATTCTATTGTGGCAAGG + Exonic
1192115703 X:68408732-68408754 TGGGCAGATCACTTGAGGCAAGG + Intronic
1193847939 X:86497764-86497786 TGGGCAGGTCACTTGAGGCCAGG + Intronic
1195968723 X:110452188-110452210 TGGGACTGTCAATTGTGGCATGG - Exonic
1195968936 X:110453787-110453809 TGTGGCTGTCATTTGTGGCATGG - Exonic
1196663396 X:118292268-118292290 TGGGCAAATCACTTGAGGCCAGG + Intergenic
1196843668 X:119881395-119881417 CGGGCCAATCACTTGAGGCCAGG + Intergenic
1198106715 X:133469012-133469034 TGGGCCAATCACTTGAGGTCAGG - Intergenic
1198324826 X:135559008-135559030 TGGGCCAATCACTTGAGGTCAGG - Intronic
1198456633 X:136823713-136823735 TGGGCCAATCACTTGAGGCCAGG + Intergenic
1198942433 X:141971346-141971368 TGGGAGAGTCACTTGAGGCCAGG - Intergenic
1201574112 Y:15443894-15443916 TCAGTCAGTGACTTGTGGCATGG + Intergenic
1201681661 Y:16651900-16651922 TGGGCCGATCACTTGAGGCCAGG - Intergenic
1201902179 Y:19054838-19054860 TGGGCAAATCACTTGAGGCCAGG + Intergenic
1201909798 Y:19122254-19122276 TGGGAGGGTCACTTGAGGCAAGG + Intergenic
1202131711 Y:21618192-21618214 TGGGCAGGTCACTTGTGGTCAGG - Intergenic