ID: 1119705729

View in Genome Browser
Species Human (GRCh38)
Location 14:76781541-76781563
Sequence CCTCCTAAGACTCCAGAACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119705729_1119705731 -9 Left 1119705729 14:76781541-76781563 CCTGGTTCTGGAGTCTTAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1119705731 14:76781555-76781577 CTTAGGAGGTTCCAACTTGCAGG 0: 1
1: 0
2: 1
3: 2
4: 72
1119705729_1119705733 15 Left 1119705729 14:76781541-76781563 CCTGGTTCTGGAGTCTTAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1119705733 14:76781579-76781601 TCCTTTCCCAGAGCCCTCCATGG 0: 1
1: 0
2: 4
3: 43
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119705729 Original CRISPR CCTCCTAAGACTCCAGAACC AGG (reversed) Exonic
900608385 1:3533910-3533932 CCTCCCAAGACCCCGGAGCCTGG - Intronic
900796585 1:4712052-4712074 ACTCCTAAAACTCCACAGCCGGG - Exonic
903969741 1:27110914-27110936 CCTCCAAAGCCCCCAGGACCTGG + Intronic
905334157 1:37232446-37232468 CCTCCATAGACCCCAGCACCAGG - Intergenic
907307607 1:53522002-53522024 CCTCCTAAGACAGCAGGGCCAGG + Intronic
909056225 1:70824522-70824544 CAGCCTAAGCCTGCAGAACCTGG + Intergenic
909713743 1:78681853-78681875 CCTCTTCAGACTCTAGAATCTGG - Intergenic
912527603 1:110295562-110295584 CCTCATGAAACTCCAGAAACGGG - Intergenic
917708283 1:177657167-177657189 CCACATAAGACTCCTGAACCGGG + Intergenic
918745128 1:188188669-188188691 CCTCTCAAGACTCCAGAAAGAGG - Intergenic
920301511 1:204991879-204991901 CCTGCTGAGACTCCAGGAACTGG - Intronic
923974710 1:239249156-239249178 CCTCCTTAGACTCTAGCACAGGG + Intergenic
1063347606 10:5326131-5326153 CTTCCTGAGCCTGCAGAACCAGG + Intergenic
1067774511 10:49153264-49153286 CATCCAATGACTCCCGAACCTGG + Intergenic
1075090869 10:119443683-119443705 CCTCCTCCGTCTCCAGGACCCGG - Exonic
1077411365 11:2405405-2405427 CCTCCTGAGACTCCCGGGCCAGG + Intronic
1077507867 11:2940464-2940486 CCTCCTCAGAACCCAGACCCTGG - Intergenic
1079456359 11:20639747-20639769 CCTCCTGGTACTCCAGAAACAGG + Intronic
1084410864 11:69005263-69005285 CCTCCTGAGACTCCAGCGCCTGG - Exonic
1086957123 11:92944673-92944695 CCACCTAAAACTTCAGCACCAGG + Intergenic
1087161898 11:94957217-94957239 CCTCCTACCTCGCCAGAACCAGG - Intergenic
1087313514 11:96578105-96578127 CTTCCTAAGACTCAAAAATCAGG - Intergenic
1088469320 11:110176728-110176750 CCTGCTAGGCCTCCAGAGCCTGG - Intronic
1091636434 12:2200555-2200577 TATCCTCAGACTCCAGAACAAGG - Intronic
1093861976 12:24176818-24176840 CCTCCTAACACTCTAGTCCCTGG + Intergenic
1099059167 12:77884416-77884438 AGTCCAAAGGCTCCAGAACCAGG + Intronic
1100459033 12:94780372-94780394 CCTCCCAGGACCCCACAACCTGG + Intergenic
1101322365 12:103684001-103684023 CTTCCCAAGAGCCCAGAACCAGG + Intronic
1106379631 13:29223775-29223797 CCTCCTGGGAGTCCAGAACTAGG + Intronic
1106831299 13:33586279-33586301 GATCCTGAGACTCCAAAACCAGG + Intergenic
1107345146 13:39452293-39452315 CCTCCTAGTACTCCATAATCTGG - Intronic
1107402673 13:40084677-40084699 ACTCCAATGACTCCAGAACCAGG + Intergenic
1107776121 13:43843895-43843917 CCTTTTAAGCCTACAGAACCTGG + Intronic
1111301112 13:86351963-86351985 CCTTCTAAACCTCCAGAACTAGG - Intergenic
1113414289 13:110116242-110116264 CGACCTGAGCCTCCAGAACCGGG + Intergenic
1114023932 14:18507170-18507192 TCACATAAGACTCCAGAACACGG + Intergenic
1118359355 14:65043076-65043098 CCTAGTAAGACTCTAGAAACAGG + Intronic
1119705729 14:76781541-76781563 CCTCCTAAGACTCCAGAACCAGG - Exonic
1119780382 14:77273061-77273083 CCTCATCAGACTCCAGACCCTGG - Intergenic
1120849561 14:89157540-89157562 CCTCATGAAACTCCAGAAACAGG + Exonic
1121009782 14:90513065-90513087 CCTCCTATGGCTCCTAAACCTGG + Intergenic
1121613828 14:95299488-95299510 CCTCCTGTGTCTCCAGCACCTGG - Intronic
1122557341 14:102588672-102588694 CATCCTAAGAGTTCTGAACCTGG - Intergenic
1128290701 15:66476402-66476424 CCTCCCAGGACTCCAGGAGCAGG + Intronic
1131792453 15:95979933-95979955 ACTCCAATGCCTCCAGAACCTGG - Intergenic
1133437256 16:5790421-5790443 CCTCCTTCCACTCCAGAAACAGG + Intergenic
1133727455 16:8550737-8550759 CCTCCTAACACTCCAGCTCTTGG + Intergenic
1134626966 16:15729191-15729213 CAGCCTAAGACCCCAGAACTGGG + Intronic
1135162321 16:20108115-20108137 CTTCCTCAGACTCCAAACCCAGG + Intergenic
1136547705 16:30965042-30965064 CCCCCGGAGCCTCCAGAACCTGG + Exonic
1137394695 16:48108599-48108621 CCTCCACAGACTCCACAACACGG + Intronic
1138236403 16:55386888-55386910 CCTTCTCAGAATCCTGAACCAGG + Intergenic
1141159134 16:81617502-81617524 CCCCCTAAGACTCATGAGCCAGG + Intronic
1141691571 16:85599734-85599756 CCTCTTAAGATCCCTGAACCTGG + Intergenic
1141795875 16:86273851-86273873 CTCCCGAAGACTCCAGGACCTGG + Intergenic
1141988838 16:87598339-87598361 TCTCCTAAGACTCAGGAATCAGG + Intergenic
1144129980 17:12237505-12237527 CCTCATGAAACTCCAGAAACAGG + Intergenic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1145312156 17:21706647-21706669 CCTCCTAGGACCCCAGTAGCAGG + Intergenic
1148874597 17:50679485-50679507 CCACCTCAGACTACAGAATCCGG + Intronic
1148895630 17:50837571-50837593 TCTCCCAAGGCTCCAGATCCAGG + Intronic
1152367169 17:79863031-79863053 CCTCCTAGCACTCCAGAGCAAGG - Intergenic
1155017898 18:21863605-21863627 CCTTTAAAGACTCCAGACCCAGG - Intronic
1158739612 18:60125264-60125286 CCTCATGAAACTCCAGAAACAGG + Intergenic
1159308104 18:66672183-66672205 AATCCAAAGACCCCAGAACCTGG - Intergenic
1160560921 18:79755304-79755326 CCTCCTCAGACTGCAGACCCCGG - Exonic
1161231515 19:3177145-3177167 CCTCCTCAGACCCCAGGACAAGG + Intronic
1161231562 19:3177302-3177324 CCTCCTCAGACGCCAGAGCAGGG + Intronic
1161732383 19:5969208-5969230 GGTCCTAAGAGTCCAGAGCCTGG - Intronic
1164102404 19:22068802-22068824 CCTGGTAAAGCTCCAGAACCTGG - Intronic
1164730458 19:30500260-30500282 CCTGCTGAGATTCTAGAACCAGG - Intronic
1164730474 19:30500389-30500411 CCTGCTGAGATTCTAGAACCAGG - Intronic
1164730517 19:30500652-30500674 CCTGCTGAGATTCTAGAACCAGG - Intronic
1164730529 19:30500717-30500739 CCTGCTGAGATTCTAGAACCAGG - Intronic
1164798573 19:31056733-31056755 CTTCCTAAGACTTCAGCCCCTGG + Intergenic
1166625426 19:44348294-44348316 CCTCCTGAGACTCCAAAGACAGG + Intronic
1167334322 19:48875237-48875259 CTTTCTAAGACTCAAGAATCTGG - Intronic
927981966 2:27380159-27380181 CCTCCTCAAACTCCAGATCCTGG + Exonic
928437406 2:31263791-31263813 CCACCTAACTCTCCAGAAGCTGG - Intronic
931567373 2:63628831-63628853 CCTCCTAAGAACCCAGATCCAGG + Intronic
934709649 2:96506587-96506609 CCTCCCAAGACCCCAGATCAAGG + Intronic
935181924 2:100699364-100699386 CCGTCCCAGACTCCAGAACCAGG + Intergenic
936528242 2:113256995-113257017 CCCCCTATGTCCCCAGAACCTGG - Intronic
937238027 2:120442340-120442362 GCCCCGAAGGCTCCAGAACCCGG + Intergenic
938646240 2:133333298-133333320 CCTCTTCAGACTTCAGGACCTGG - Intronic
941454820 2:165702792-165702814 CCTGCTAGGACTTCAGGACCTGG + Intergenic
941665302 2:168239018-168239040 CCTGCTAAGACCATAGAACCGGG - Intronic
942135208 2:172918753-172918775 GCTCCAAAGACTCCAGGACCTGG - Intronic
946086104 2:217173494-217173516 ACTCTTAGGATTCCAGAACCTGG - Intergenic
946506011 2:220301588-220301610 CCTCCCAAGGGTCCAGAATCTGG + Intergenic
946992191 2:225346233-225346255 CCTGTAAAGCCTCCAGAACCAGG + Intergenic
948061355 2:235045084-235045106 CCTCCTGGCTCTCCAGAACCTGG + Intronic
948347974 2:237315057-237315079 CCTCCTTAGGCTCCAGGAGCAGG - Intergenic
1169415413 20:5412020-5412042 CGGCCTCAGACTCCAGACCCTGG + Intergenic
1169899031 20:10534493-10534515 CCTTCTAAGGCTCCAGACCAGGG - Intronic
1170208792 20:13827383-13827405 CCTCCTTACACTCCAGCACCCGG - Intergenic
1171196641 20:23205082-23205104 CCTCCTAGGAATCCAGACCCGGG + Intergenic
1171464708 20:25319440-25319462 CCTGCAAAGACCCCAGCACCTGG + Intronic
1174246501 20:49186098-49186120 CCTCCTAGGCCTCCATAAGCAGG - Intronic
1176945920 21:14981502-14981524 CCTCCTGAGTCTCCCCAACCTGG - Intronic
1178041342 21:28643563-28643585 CCACCTAAGCCTCCAGTAGCTGG - Intergenic
1179007891 21:37530914-37530936 CCTCATAACACTGCAGACCCGGG - Intergenic
1179724508 21:43334314-43334336 CCTCCTCAGTCTCCTGAAGCTGG + Intergenic
1180448102 22:15434701-15434723 TCACATAAGACTCCAGAACACGG + Intergenic
1180698004 22:17766039-17766061 CCCCCTCAGCCTCCAGAGCCGGG + Intronic
1181403233 22:22664426-22664448 CCTCCTGAGACTCAAGCACTGGG - Intergenic
1181415911 22:22758694-22758716 CCTCCTGAGACCCCAGCACTGGG - Intronic
1181420206 22:22792486-22792508 CCTCCTGAGACCCCAGCACTGGG - Intronic
1181424247 22:22822774-22822796 CCTCCTGAGACCCCAGCACTGGG - Intronic
1181428036 22:22856543-22856565 CCTCCTGAGACCCCAGCACTGGG - Intronic
1181977021 22:26737473-26737495 CCTCCTGAGACTCTAGGATCTGG - Intergenic
949450722 3:4181922-4181944 GCTCTGAAGACTCCAGAACCTGG + Intronic
950440139 3:13005729-13005751 CCTACGAAGCCTCCAGAGCCAGG - Intronic
951577701 3:24130536-24130558 CCTCCTCAGACCCAAGAACTGGG + Intronic
954624841 3:52016738-52016760 CCTCCTAAGACTCCCCACCCAGG - Intergenic
954719830 3:52552206-52552228 CCACCTTAGATTCCAGAACACGG + Intronic
957602574 3:82357096-82357118 CCGTCTCAGACTCCAGAGCCAGG + Intergenic
958912464 3:100009709-100009731 CCTCCTATGACTCAAGAAAAAGG - Intronic
963025404 3:140914006-140914028 CCTCCTGAGACTACAGAACCAGG + Intergenic
963707888 3:148711014-148711036 CCTTGTAAGCCTGCAGAACCAGG + Intronic
964053965 3:152429031-152429053 CCTACTAAATCTCCAGAGCCTGG - Intronic
967119378 3:186369235-186369257 CCTGCTCAGACTCCAGGGCCTGG - Intergenic
967396537 3:189015573-189015595 CCTCTTAAGCCTCCAGGACTGGG - Intronic
967839850 3:193996429-193996451 CCTGCTGAGTCTCCAGCACCAGG + Intergenic
969248495 4:5952157-5952179 CCTCTTACGACTCCTGACCCTGG - Intronic
975712737 4:77176677-77176699 CATCCTAAGCCACCAGAACATGG + Intronic
981590920 4:146360048-146360070 CCACCTAATAGTCCAAAACCAGG + Intronic
984139720 4:175989003-175989025 CCTCCAAAGACTACAGAATTGGG - Intronic
984570480 4:181386932-181386954 CCCACTAAGACTCCAAATCCTGG - Intergenic
986144621 5:5065768-5065790 CCTCCTCAGACCCCAGAGGCTGG - Intergenic
991001459 5:61787713-61787735 CCTGCTCAGACTCCTGAAGCCGG + Intergenic
991436745 5:66604027-66604049 CCTCCTAGGAATTCTGAACCAGG - Intronic
992436378 5:76759576-76759598 CCTCCCTACACCCCAGAACCAGG + Intergenic
1005389169 6:25315900-25315922 CCTCCCAGGCCTACAGAACCAGG + Intronic
1006846993 6:37069225-37069247 CCTCCAAGGACTCCAGAAAGAGG + Intergenic
1009484797 6:64207346-64207368 CCTTCCAAGGCTCCAGAACGAGG + Intronic
1010678413 6:78770569-78770591 CCTCCAAAGACTCCAGACTCTGG + Intergenic
1019459493 7:1149416-1149438 CCACCTCAGACCACAGAACCAGG + Intergenic
1030365157 7:108637429-108637451 GCTCCAAAGTCTCCAGAAGCTGG + Intergenic
1032865365 7:135919323-135919345 CCTACTAATACTTCAGATCCAGG - Intergenic
1034393964 7:150805870-150805892 CCACCTAAGACTCAAAGACCAGG + Intergenic
1034410261 7:150937453-150937475 CCTCCTCATTCTCCAGGACCTGG - Intergenic
1036398283 8:8386636-8386658 CCTCCAAAGTCTCCAGGCCCCGG + Intergenic
1036398529 8:8387727-8387749 CCTCCTAAGAGGACAGAATCTGG + Intergenic
1037050652 8:14368704-14368726 CATCCTAAGTCTGCAGATCCTGG + Intronic
1038363394 8:26906045-26906067 CCACTTAAGACTCCAGAGCAAGG - Intergenic
1039026862 8:33268075-33268097 CCTCCCAAGATGCCAGTACCAGG + Intergenic
1041551812 8:59111296-59111318 CCTAATAAGACTAAAGAACCAGG - Intronic
1048236205 8:132693125-132693147 CCTCTGATGACTGCAGAACCAGG + Intronic
1048993665 8:139775760-139775782 CCTCCGAAGGCTCCAGAATTTGG - Intronic
1049787788 8:144459324-144459346 CCACCTGAGACTCCAGAAGGTGG + Intronic
1050186641 9:2981996-2982018 ACTCCCCAGACTCCAGAACTGGG - Intergenic
1050327114 9:4508489-4508511 ACTCCTAAGACTCCATCCCCAGG + Intronic
1053543495 9:38998776-38998798 CCTCCAAAGACAGCAGAGCCTGG - Intergenic
1053807926 9:41822281-41822303 CCTCCAAAGACAGCAGAGCCTGG - Intergenic
1054622666 9:67365147-67365169 CCTCCAAAGACAGCAGAGCCTGG + Intergenic
1057262246 9:93591646-93591668 CCTAGGAAGACTCCAGACCCTGG + Intronic
1058072284 9:100613596-100613618 CTTCCTAATACTCCAGAAAAGGG - Intergenic
1188900427 X:35725964-35725986 CCTCCAAAGCATACAGAACCTGG - Intergenic
1189488702 X:41452844-41452866 CCTCCTGTGACCCCAGAACTTGG - Intronic
1190496314 X:51031351-51031373 CCTCCTCAGCCTCAAGAGCCTGG + Intergenic
1190509694 X:51162738-51162760 CCTCCTCAGCCTCAAGAGCCTGG - Intergenic
1192938646 X:75888683-75888705 CCTCATGAAACTCCAGAAACAGG - Intergenic
1196645714 X:118116241-118116263 TCTTCTAGGACCCCAGAACCCGG - Intronic
1197978950 X:132195618-132195640 CCTTCTTTGACTCCAGAAACAGG - Intergenic
1199439203 X:147849099-147849121 CCTGCTAAAACTGCAGAACCAGG - Intergenic