ID: 1119706227

View in Genome Browser
Species Human (GRCh38)
Location 14:76784287-76784309
Sequence AGCACGCACCTGCCTAATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119706225_1119706227 -6 Left 1119706225 14:76784270-76784292 CCATTCCTCAGGCTCACAGCACG No data
Right 1119706227 14:76784287-76784309 AGCACGCACCTGCCTAATTTAGG No data
1119706221_1119706227 11 Left 1119706221 14:76784253-76784275 CCTCATTTCCTGCTGTCCCATTC No data
Right 1119706227 14:76784287-76784309 AGCACGCACCTGCCTAATTTAGG No data
1119706223_1119706227 3 Left 1119706223 14:76784261-76784283 CCTGCTGTCCCATTCCTCAGGCT No data
Right 1119706227 14:76784287-76784309 AGCACGCACCTGCCTAATTTAGG No data
1119706224_1119706227 -5 Left 1119706224 14:76784269-76784291 CCCATTCCTCAGGCTCACAGCAC No data
Right 1119706227 14:76784287-76784309 AGCACGCACCTGCCTAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119706227 Original CRISPR AGCACGCACCTGCCTAATTT AGG Intergenic
No off target data available for this crispr