ID: 1119709023

View in Genome Browser
Species Human (GRCh38)
Location 14:76807908-76807930
Sequence GACCCTGATGTGAGTGAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119709023_1119709028 2 Left 1119709023 14:76807908-76807930 CCCTCTTCACTCACATCAGGGTC 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1119709028 14:76807933-76807955 AGTGCTGGAATTCCTGCATGAGG 0: 1
1: 0
2: 0
3: 29
4: 198
1119709023_1119709030 29 Left 1119709023 14:76807908-76807930 CCCTCTTCACTCACATCAGGGTC 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1119709030 14:76807960-76807982 CGAAGCGATAGTTCCAATTGAGG 0: 1
1: 0
2: 0
3: 0
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119709023 Original CRISPR GACCCTGATGTGAGTGAAGA GGG (reversed) Exonic
900463095 1:2810658-2810680 GTCCCTGGTGTGAGGGAACAAGG - Intergenic
900573295 1:3370635-3370657 CACCCTGATGTGAGGGACCAGGG + Intronic
901669060 1:10843684-10843706 GACCATGATGTGCCTGAATATGG + Intergenic
901890577 1:12260088-12260110 GAGCCTGCAGTGAGTGGAGATGG - Intronic
903181907 1:21609061-21609083 TACCCTTTTGGGAGTGAAGAGGG - Intronic
905246156 1:36615461-36615483 GGTCCTGATGTGACTGCAGAAGG + Intergenic
905605441 1:39294813-39294835 GACCCAGATGTGAGTAAAATGGG - Intronic
906124419 1:43418678-43418700 GAAGCAGATGAGAGTGAAGAGGG + Intronic
907906761 1:58789442-58789464 GAGCCTGATGTCAGTGAGGAGGG + Intergenic
910902621 1:92138037-92138059 AACTCTGATTTGAGTGAAGGCGG + Intronic
913134627 1:115876156-115876178 GAAGCTGAAGTGAGTCAAGATGG + Intergenic
913231089 1:116741310-116741332 GACCTTTATGTGAGTGGACATGG + Intergenic
913942264 1:125119611-125119633 GGCCCCGATGGGAGAGAAGAAGG + Intergenic
919777150 1:201201735-201201757 GACCCTGATGTGTCTTAAGCTGG - Exonic
920431506 1:205921898-205921920 GACCTTGCTGTGACTGAAGCAGG + Intronic
924634591 1:245774124-245774146 GGCCAGAATGTGAGTGAAGAAGG + Intronic
924800809 1:247328829-247328851 GACCCTGTGGTGATTGATGATGG - Exonic
1062786378 10:268776-268798 GACACTGGTGTGACTGGAGAGGG + Intergenic
1066954148 10:42149504-42149526 GGCCCCGATGGGAGAGAAGAAGG - Intergenic
1067808998 10:49412601-49412623 CACCTTGAAGTGAGAGAAGAAGG + Intergenic
1068479254 10:57568709-57568731 GAGAGTGATGTCAGTGAAGATGG + Intergenic
1068731951 10:60367947-60367969 GAGCCTGCTGTGAATGCAGATGG + Intronic
1068786926 10:60987030-60987052 GACCCAGATGTGAGACAAAACGG + Intronic
1069283233 10:66681578-66681600 GAGCCTAAGGTGATTGAAGAGGG - Intronic
1069853410 10:71425086-71425108 GTACCTAATGTCAGTGAAGAGGG + Intronic
1071253946 10:83849957-83849979 GACCCTGCTTTGAGGGTAGAGGG + Intergenic
1072522418 10:96240106-96240128 GTACCTGCTGTGAGGGAAGATGG - Intronic
1074801620 10:117005736-117005758 GACCATGCCGTGAGTGAAGGAGG + Intronic
1075844433 10:125534170-125534192 GACCCTGGTGGGAGCAAAGAGGG + Intergenic
1076327440 10:129637258-129637280 GAGCCTGGTGTAAGTGCAGATGG + Intronic
1076504350 10:130962198-130962220 GACCCTGGTCTCAGGGAAGAGGG - Intergenic
1076691809 10:132227559-132227581 GACGGTGATGAGAGTGATGATGG + Intronic
1077206458 11:1346884-1346906 GCCCCTGAGGTGGGTGAGGAGGG + Intergenic
1078401969 11:11036726-11036748 GACTCTGATGTCTGTGCAGAGGG + Intergenic
1081848476 11:46258304-46258326 GACCCTGATGAGGGTGATCAGGG + Intergenic
1084779973 11:71401631-71401653 GACCCTGCTGTGAGGGCTGAGGG - Intergenic
1085460444 11:76690042-76690064 GACCCTGATGTGTGTGGCAAGGG + Intergenic
1085745882 11:79113802-79113824 GACCCTTATAGGAGTGGAGAAGG + Intronic
1086739837 11:90353226-90353248 GAGCCTGATGAGAGCGGAGAGGG + Intergenic
1086997847 11:93379096-93379118 GGAACTGATGTTAGTGAAGAAGG - Intronic
1088554232 11:111045352-111045374 GACACTGATGTCAGTGACAAGGG + Intergenic
1089138815 11:116270358-116270380 GACCCTTGTGTGAGTGACCATGG - Intergenic
1090101484 11:123801898-123801920 GAAACTGATGTCAGTGACGAAGG - Intergenic
1091250594 11:134141081-134141103 GATCCTGATGTGAGTGATGTAGG + Intronic
1092590210 12:9946476-9946498 GACCCTGGGGTGGGGGAAGATGG - Intergenic
1099658429 12:85524936-85524958 GAACATCATGTGAATGAAGATGG - Intergenic
1100062863 12:90602871-90602893 GACCTTGGTGTAAATGAAGATGG + Intergenic
1100250524 12:92817614-92817636 GACCCTGAAGTAAGAGATGATGG - Intronic
1102487538 12:113268438-113268460 ATCCCTGATGTGAGTGGCGAGGG + Intronic
1106124586 13:26889956-26889978 GACCCTGAAGTGAGTAGTGAGGG + Intergenic
1106896408 13:34307521-34307543 TACCCTGATGTGATTGATGCAGG + Intergenic
1110718394 13:78733499-78733521 GAGCCTAATGTGAGTGACCAAGG - Intergenic
1110745253 13:79045227-79045249 GATCAGGATGTGAATGAAGAGGG - Intergenic
1113301504 13:109026755-109026777 GAACTTGATCTGAGGGAAGATGG - Intronic
1113899114 13:113786363-113786385 GACGGTGATGACAGTGAAGACGG - Intronic
1116760791 14:49011017-49011039 GATACTAATGTGAGGGAAGATGG - Intergenic
1117514772 14:56489849-56489871 GACATTGATGGGAATGAAGATGG - Intronic
1118841660 14:69517848-69517870 TACCCTGATGGGAGTGAGGCAGG - Intronic
1119709023 14:76807908-76807930 GACCCTGATGTGAGTGAAGAGGG - Exonic
1119888833 14:78167307-78167329 GTCCCTGAACTGAGTGAAGATGG + Intergenic
1122852357 14:104543502-104543524 GACACTGATGAGAATGAAGCCGG + Intronic
1122950687 14:105042851-105042873 GATCCTGATGTGTGTGAAGGTGG - Intergenic
1123800373 15:23812927-23812949 GACCATGATGTAAGGTAAGATGG + Intergenic
1134187121 16:12093228-12093250 GGCCCTGATGTCAGTGATCACGG + Intronic
1134326417 16:13212003-13212025 GTCCCTCTTGTGAGTGATGAGGG + Intronic
1134812744 16:17181258-17181280 GATCGTGATGAGAGTGAGGAAGG - Intronic
1136155843 16:28381467-28381489 GAAGGTGATGTGAGTGAGGAAGG - Intronic
1136207242 16:28733822-28733844 GAAGGTGATGTGAGTGAGGAAGG + Intronic
1136696275 16:32084472-32084494 GGCCCCGATGGGAGAGAAGAAGG - Intergenic
1136796770 16:33027724-33027746 GGCCCCGATGGGAGAGAAGAAGG - Intergenic
1136867918 16:33771054-33771076 GGCCGCGATGTGAGAGAAGAAGG + Intergenic
1137084231 16:36101349-36101371 GGCCCTGATGGGAGAGAAGAAGG - Intergenic
1138880029 16:61001858-61001880 GAGGCTGTAGTGAGTGAAGATGG + Intergenic
1140779301 16:78279885-78279907 GACCCAGGTGTGAGTGCATAGGG + Intronic
1141736195 16:85855536-85855558 GAGGCTGCTGTGAGTGGAGATGG - Intergenic
1203104259 16_KI270728v1_random:1345224-1345246 GGCCGCGATGTGAGAGAAGAAGG - Intergenic
1203129255 16_KI270728v1_random:1617144-1617166 GGCCGCGATGTGAGAGAAGAAGG + Intergenic
1144044413 17:11442082-11442104 GAGGCTGATGACAGTGAAGAAGG - Intronic
1145690203 17:26731752-26731774 GGCCCCGATGGGAGAGAAGAAGG + Intergenic
1149421081 17:56511201-56511223 GGCCCCGATGTGAGTCAGGAGGG + Intronic
1151518656 17:74613428-74613450 GACCCTGAGGGGAGGGAACAAGG - Intronic
1153775990 18:8454371-8454393 TACCCTCATGTGAGTGAATTTGG + Intergenic
1156546806 18:37971813-37971835 TACACTGAAGTGAGTGAAGATGG - Intergenic
1158561605 18:58518687-58518709 GACCCTGATGGGCCTGGAGATGG + Intronic
1159007774 18:63028045-63028067 GACCCTCAAGTGAGGCAAGATGG - Intergenic
1160114744 18:76066920-76066942 GACCAGGATGTGAGTGTGGAAGG - Intergenic
1160119929 18:76121223-76121245 GACCCCGCTATGAGAGAAGAGGG - Intergenic
1160443728 18:78911987-78912009 GACCCTGAGGTGGGAGAAGGAGG - Intergenic
1164443813 19:28300221-28300243 GCCCCTAATGTGAGAGATGAAGG - Intergenic
1164854781 19:31512431-31512453 TACCCGGCTGTGAGAGAAGATGG - Intergenic
1168401002 19:56086381-56086403 CACCCTGATGTGCTTGAGGAGGG - Intergenic
1168667011 19:58211700-58211722 AGCCCTGAGGTGGGTGAAGAGGG - Intronic
925809540 2:7685667-7685689 GACACTGATGTGAGTGGTAATGG - Intergenic
926349708 2:11983777-11983799 AACCCTGAGGTGAGTGAGGGTGG - Intergenic
926749643 2:16188441-16188463 GACACTGCTGAGAGTGAACAGGG + Intergenic
928108191 2:28486379-28486401 GAGCCTGAGGTCAGAGAAGATGG + Intronic
929714380 2:44295423-44295445 GACCTTCATGGGAGTAAAGAGGG + Intronic
936019679 2:108985384-108985406 GACCGTGAAGTGAGTTAAGCTGG + Intronic
936488523 2:112948151-112948173 GATCCTGATGAGAGTGTGGATGG + Intergenic
938307232 2:130264482-130264504 GGCCTTGATGTGAGTCAAGCTGG - Intergenic
938406148 2:131034456-131034478 GACGCTGCGGTCAGTGAAGAGGG + Intronic
940514367 2:154662155-154662177 GACCCTGATATTGGTGAAAATGG + Intergenic
941816367 2:169799475-169799497 AAACCTGATGTGAGCGATGAAGG - Exonic
943575300 2:189624899-189624921 TTCTCTGAGGTGAGTGAAGAAGG - Intergenic
946477551 2:220023092-220023114 AACCTAGATGGGAGTGAAGATGG + Intergenic
947864890 2:233389766-233389788 GACCCTGTAGGGAGTGGAGAGGG + Intronic
948459573 2:238122668-238122690 GAACCTGCTGTCAGTGGAGAGGG - Intronic
1169477335 20:5943502-5943524 CACCCTGATGTGAGTAAAGGTGG - Intronic
1170108603 20:12780064-12780086 GACCCTGCTGGGAGTAAAGATGG + Intergenic
1170187754 20:13610380-13610402 TACCCTGAGGTGACTGAAGGGGG + Intronic
1170638878 20:18134193-18134215 CACCCTTGTGTGAGTGAAGGTGG + Intergenic
1173322184 20:41998140-41998162 GACCTTTATGTGAGTGGACACGG + Intergenic
1173501769 20:43559081-43559103 GACCATGAAGAGAGAGAAGAGGG + Intronic
1173993972 20:47323776-47323798 GAGCCTCATTTGAGTGGAGAGGG - Intronic
1176273123 20:64246784-64246806 GACCCTGGTGGGAGGGAGGAAGG + Intergenic
1176514716 21:7775352-7775374 GACACTGAAGGGAGAGAAGAAGG - Intergenic
1178523208 21:33303312-33303334 GCCCCTGCAGTGAGTGATGAGGG + Intergenic
1178648829 21:34405876-34405898 GACACTGAAGGGAGAGAAGAAGG - Intronic
1181317346 22:21979203-21979225 GACTCTGAGTTGGGTGAAGAGGG + Intronic
1181386862 22:22552752-22552774 GACCCTGAGGTGACAGTAGAAGG + Intronic
1181582829 22:23837417-23837439 GGTCCTGATGGGAGTGAGGATGG - Intronic
1181816177 22:25438243-25438265 GACCCTGAGGACACTGAAGATGG - Intergenic
1184391246 22:44204827-44204849 CAGCCTGGTGTGGGTGAAGAGGG - Intronic
1203324985 22_KI270738v1_random:4875-4897 GGCCCCGATGGGAGAGAAGAAGG - Intergenic
950967445 3:17155963-17155985 CACCCTGATGTGAGTGCTGGTGG - Intergenic
952458409 3:33497590-33497612 GATCCTGATGAGAGAGAAGATGG - Exonic
952747522 3:36795204-36795226 GACACTGAAGTGAATGAATATGG - Intergenic
955424734 3:58776420-58776442 GACCCTTATGGGCCTGAAGATGG + Intronic
955828828 3:62979942-62979964 GACCCTGAAAAGAGAGAAGAGGG - Intergenic
956019408 3:64917438-64917460 GACTCTGATTTTAGTTAAGATGG - Intergenic
960323779 3:116269649-116269671 GACGCTTCTGAGAGTGAAGAGGG + Intronic
961008949 3:123423502-123423524 GGTCCTGATGGGAGGGAAGAGGG + Intronic
963972842 3:151448404-151448426 GCCCCTTATGTCAGTGAGGATGG - Exonic
965498208 3:169424535-169424557 GACCATCATGTGAAAGAAGATGG + Intronic
965817036 3:172647699-172647721 GACCCTTTTGAGAGTGAAAAGGG + Intronic
967636370 3:191806609-191806631 GAGCCTAATGTGAGTGACCATGG - Intergenic
969109847 4:4837499-4837521 GACCCGGATGAGACTGAAGAAGG - Intergenic
969301569 4:6300309-6300331 GACCCTGAGGGGAGGGAAGTGGG + Intronic
971062604 4:22989514-22989536 GAACCTGAGGTGAGTGAGAAGGG + Intergenic
981934849 4:150228622-150228644 GACCCAGCTGTGAGTGAGCAGGG + Intronic
985127390 4:186708341-186708363 GACCCTGATGAGGGTGAGAACGG - Exonic
987706812 5:21469281-21469303 GAACCTGCAGTGAGTGGAGATGG - Intergenic
989541606 5:42625473-42625495 GAGCCAAATGTGAGTGAACATGG + Intronic
995542183 5:113196257-113196279 GAGCCTGATGTCAGGAAAGAGGG - Intronic
997452176 5:133992566-133992588 GACCCTGCTGGGAGTGCAGGTGG - Intronic
997585397 5:135040351-135040373 GCCCCTGAGGAGAGGGAAGAAGG - Intronic
997781218 5:136660488-136660510 AACACTGAAGTCAGTGAAGATGG - Intergenic
997919217 5:137962417-137962439 GACCGTGGTGATAGTGAAGATGG - Exonic
998052157 5:139044998-139045020 GAACATGAAGTGAGTGAAGAAGG - Intronic
1000364733 5:160480285-160480307 GAGCCTGCCGTGAGTGCAGAGGG - Intergenic
1002860412 6:1074844-1074866 GACCCTGATGTATGTGCAGTTGG - Intergenic
1003181658 6:3797323-3797345 TAGCCTGAAGTGAGTGATGATGG - Intergenic
1003191664 6:3880212-3880234 GAGCCTGCAGTGAGTGGAGATGG - Intergenic
1004255996 6:14065080-14065102 GACTCTGTCGTGAGTGAAGATGG - Intergenic
1004451326 6:15749838-15749860 GTCTCTGCTGTGATTGAAGAGGG - Intergenic
1004743447 6:18486501-18486523 GACACTGATGTGTTAGAAGAGGG + Intergenic
1006845664 6:37059759-37059781 GACCCTGCTGTGTGCGGAGAGGG + Intergenic
1007652591 6:43432608-43432630 GAACCTGAGGTGGCTGAAGATGG + Exonic
1008540795 6:52545205-52545227 GACCCAGCTGTGAGTTCAGATGG - Intronic
1009649666 6:66458665-66458687 TACTCTGATGTGAGTAGAGAGGG - Intergenic
1013708230 6:112864892-112864914 GACCCTGGGGTAGGTGAAGAAGG + Intergenic
1014666653 6:124246354-124246376 GATGCTGATGTGAGTCAAGTTGG - Intronic
1018322362 6:162625018-162625040 GAGCCTTACCTGAGTGAAGAAGG - Intronic
1018544094 6:164916678-164916700 GCCCCTGATGTGTGTGGAAATGG - Intergenic
1022093146 7:27120929-27120951 GCCGGTGAAGTGAGTGAAGAGGG - Intronic
1023514192 7:40984150-40984172 AACCCTGATGTAAAGGAAGAAGG - Intergenic
1025320377 7:58088073-58088095 GGCCCCGATGGGAGAGAAGAAGG + Intergenic
1025553373 7:62275633-62275655 GGCCCCGATGGGAGGGAAGAAGG - Intergenic
1025561420 7:62377804-62377826 GGCCCCGATGGGAGAGAAGAAGG + Intergenic
1030632140 7:111907616-111907638 AACCCTGATGTGCGAGGAGATGG - Intronic
1035040025 7:155920572-155920594 AACGCTGATGTGATTGAAGCAGG - Intergenic
1035461611 7:159042719-159042741 AACCCAGATGTGTGTGAGGAAGG + Intronic
1036931191 8:12957590-12957612 GACACTTTTGAGAGTGAAGAGGG + Intronic
1038699655 8:29837504-29837526 GAGCCTAATCTGGGTGAAGAGGG + Intergenic
1039984516 8:42436433-42436455 GATGCGGATGTGAGAGAAGAAGG - Intronic
1041153082 8:54956559-54956581 GAAGGTGATGTGAATGAAGATGG - Intergenic
1044562014 8:93621652-93621674 GACACTGATGTAAATGAAGGAGG - Intergenic
1045868079 8:106892276-106892298 GACACTTATGAGAGTGAAAAGGG + Intergenic
1046573904 8:116001136-116001158 GACACTGGTGGGAGTGAGGAGGG - Intergenic
1046650068 8:116828104-116828126 GAGCCTGCAGTGAGTGCAGAAGG - Intronic
1049748448 8:144272771-144272793 GACCCTGGGGTCAGTGATGAGGG - Intronic
1052947491 9:34179581-34179603 GACCCAGATTTTAGTAAAGAAGG + Intronic
1052950092 9:34201847-34201869 AACCCTGACATGAGTGAAGCTGG - Intronic
1058426985 9:104883785-104883807 GACCGTGATGTGAGTTAGGACGG - Intronic
1060432197 9:123560368-123560390 GACACTAAACTGAGTGAAGATGG + Intronic
1060982875 9:127803607-127803629 GACCCTGATGCCAGTGAGGCGGG + Intronic
1186972208 X:14859921-14859943 AACCCTGATGTGGGTGTGGAGGG + Intronic
1188143918 X:26586523-26586545 GCCTCTGAGGTGAGTGGAGAGGG + Intergenic
1188444922 X:30246355-30246377 GACCTTGATGTGAGAGGAGCAGG + Exonic
1190062815 X:47221966-47221988 GGCCCTGCTGTGAGTCCAGATGG + Intronic
1195694414 X:107656062-107656084 GACCCTTTTGAGAGTGAAGGGGG - Intergenic
1196681706 X:118476141-118476163 AAGCCTGATGTGAGTGAGCAAGG + Intergenic