ID: 1119714941

View in Genome Browser
Species Human (GRCh38)
Location 14:76852531-76852553
Sequence CCTCATGGTCACCATCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 140}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119714933_1119714941 2 Left 1119714933 14:76852506-76852528 CCCATCCTGCCATCCTAAGCCTC 0: 1
1: 0
2: 2
3: 22
4: 291
Right 1119714941 14:76852531-76852553 CCTCATGGTCACCATCAATGAGG 0: 1
1: 0
2: 1
3: 28
4: 140
1119714935_1119714941 -3 Left 1119714935 14:76852511-76852533 CCTGCCATCCTAAGCCTCTTCCT 0: 1
1: 0
2: 3
3: 26
4: 348
Right 1119714941 14:76852531-76852553 CCTCATGGTCACCATCAATGAGG 0: 1
1: 0
2: 1
3: 28
4: 140
1119714932_1119714941 5 Left 1119714932 14:76852503-76852525 CCTCCCATCCTGCCATCCTAAGC 0: 1
1: 0
2: 1
3: 18
4: 326
Right 1119714941 14:76852531-76852553 CCTCATGGTCACCATCAATGAGG 0: 1
1: 0
2: 1
3: 28
4: 140
1119714929_1119714941 26 Left 1119714929 14:76852482-76852504 CCCAGTTGAGGACAGCCAGGGCC 0: 1
1: 1
2: 6
3: 17
4: 188
Right 1119714941 14:76852531-76852553 CCTCATGGTCACCATCAATGAGG 0: 1
1: 0
2: 1
3: 28
4: 140
1119714931_1119714941 11 Left 1119714931 14:76852497-76852519 CCAGGGCCTCCCATCCTGCCATC 0: 1
1: 0
2: 3
3: 68
4: 493
Right 1119714941 14:76852531-76852553 CCTCATGGTCACCATCAATGAGG 0: 1
1: 0
2: 1
3: 28
4: 140
1119714936_1119714941 -7 Left 1119714936 14:76852515-76852537 CCATCCTAAGCCTCTTCCTCATG 0: 1
1: 0
2: 4
3: 34
4: 414
Right 1119714941 14:76852531-76852553 CCTCATGGTCACCATCAATGAGG 0: 1
1: 0
2: 1
3: 28
4: 140
1119714934_1119714941 1 Left 1119714934 14:76852507-76852529 CCATCCTGCCATCCTAAGCCTCT 0: 1
1: 0
2: 5
3: 52
4: 543
Right 1119714941 14:76852531-76852553 CCTCATGGTCACCATCAATGAGG 0: 1
1: 0
2: 1
3: 28
4: 140
1119714930_1119714941 25 Left 1119714930 14:76852483-76852505 CCAGTTGAGGACAGCCAGGGCCT 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1119714941 14:76852531-76852553 CCTCATGGTCACCATCAATGAGG 0: 1
1: 0
2: 1
3: 28
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119714941 Original CRISPR CCTCATGGTCACCATCAATG AGG Intronic
900827709 1:4939996-4940018 CCTCATGGTTGCCAGCAAGGAGG + Intergenic
902462913 1:16592419-16592441 CCTGAGGGTCACCACCAATGGGG + Intronic
902822831 1:18954024-18954046 CCTCATGGTCAATGTCATTGGGG - Intronic
903158607 1:21468313-21468335 CCTGAGGGTCACCACCAATGGGG - Intronic
904287330 1:29461011-29461033 CCCCAAGGCCACCATCACTGGGG - Intergenic
904370593 1:30045380-30045402 CCCCAAGGCCACCATCACTGGGG - Intergenic
907645359 1:56236991-56237013 CCTCATGGGCACCAGCAGTTAGG + Intergenic
908242581 1:62199822-62199844 CCCCAGGGTCACTATGAATGTGG + Intronic
913543609 1:119844873-119844895 CTTGAGGGTCACCACCAATGGGG + Intergenic
913602563 1:120436104-120436126 CCTGAGGGTCACCACCAATGGGG - Intergenic
913640162 1:120805171-120805193 CCTGAGGGTCACCACCAATGGGG - Intergenic
914084480 1:144440401-144440423 CCTGAGGGTCACCACCAATGGGG + Exonic
914190492 1:145405670-145405692 CCTGAGGGTCACCACCAATGGGG + Intronic
914212351 1:145591458-145591480 CCTGAGGGTCACCACCAATGGGG + Intergenic
914278312 1:146145167-146145189 CCTGAGGGTCACCACCAATGGGG + Intronic
914363737 1:146959731-146959753 CCTGAGGGTCACCACCAATGGGG - Intronic
914487937 1:148127394-148127416 CCTGAGGGTCACCACCAATGGGG + Intronic
914539359 1:148596115-148596137 CCTGAGGGTCACCACCAATGGGG + Intronic
914588301 1:149082536-149082558 CCTGAGGGTCACCACCAATGGGG + Intronic
914627320 1:149475513-149475535 CCTGAGGGTCACCACCAATGGGG - Intergenic
914924244 1:151870571-151870593 CCTCATTGTCTCCATCACAGAGG + Intergenic
915529430 1:156494790-156494812 CCTCAAGGTCACCAGAAATAAGG + Intronic
916380618 1:164206947-164206969 CCTAATGGCCACATTCAATGTGG + Intergenic
916552807 1:165865142-165865164 CTACATGGTCACCAATAATGGGG - Intronic
918996765 1:191771958-191771980 GATAATGGTCACCATCACTGAGG + Intergenic
920910633 1:210213266-210213288 TCTCTTGGTCACCATGCATGTGG + Intergenic
924256652 1:242189894-242189916 CCTCAGGAACACCATGAATGAGG + Intronic
924263458 1:242255151-242255173 CCTCATGGTTATCATGAATGTGG - Intronic
924516139 1:244767984-244768006 CCTCATGGCCACCACCACCGTGG + Intergenic
1065204018 10:23341429-23341451 CCCCATGGTCATCTTCCATGAGG + Intronic
1066721339 10:38343319-38343341 CCTCATGGTTATCATGAATGTGG + Intergenic
1067562384 10:47312891-47312913 GCTCATGGGCAACATCACTGGGG + Exonic
1067910563 10:50342688-50342710 CCTTATGGTTTCCATGAATGAGG - Intronic
1069808737 10:71142893-71142915 CTTCAGGGTCACCTTGAATGGGG + Intergenic
1073103958 10:101021794-101021816 CATCATGCTGACCATCAAGGTGG - Exonic
1073904052 10:108256251-108256273 CCCCATGGTGGCCATCAATGAGG + Intergenic
1074509565 10:114100244-114100266 CTTCATGATCACCATCTTTGTGG + Intergenic
1075085397 10:119411182-119411204 CCTCATGGTCACCACCAAAGAGG + Intronic
1075541542 10:123318180-123318202 CCTCATGGCCCCCAGCAGTGAGG - Intergenic
1075722703 10:124596786-124596808 CCTCATATTCACCATCATGGTGG - Intronic
1080527112 11:33133837-33133859 CCTCTTAGTCTCCTTCAATGTGG - Intronic
1082973913 11:59053581-59053603 CCTCATGATCATCACCTATGAGG + Intergenic
1085570730 11:77555873-77555895 CCACCTGGTGACCATCAAAGAGG + Intronic
1088738897 11:112750916-112750938 CCTCATGGGCACCAGCCTTGAGG + Intergenic
1089009623 11:115121918-115121940 CCTCCAGGCCACCATCAAAGTGG - Intergenic
1089797717 11:120996046-120996068 TCACTTGGTCAGCATCAATGTGG + Intergenic
1091111358 11:132971957-132971979 CCTCTTGGCAAGCATCAATGTGG + Intronic
1091290642 11:134437645-134437667 TATCATGGACACCATAAATGTGG - Intergenic
1098003128 12:65967011-65967033 CTTTATGGTCACCATCAGAGAGG + Intergenic
1099893829 12:88620535-88620557 CCTGATGCTCACCATTTATGTGG + Intergenic
1101037904 12:100723036-100723058 ACTCATGGTCAACATCGATTAGG + Intronic
1104183788 12:126408752-126408774 GCTCCTTGTCACCATCAAGGTGG + Intergenic
1104763845 12:131313891-131313913 CTTCATGGCCACACTCAATGGGG + Intergenic
1104998871 12:132675748-132675770 CATCATGGTCACCTACAACGGGG - Exonic
1105543562 13:21335899-21335921 CCTCAGGGTAACCACCAACGTGG - Intergenic
1110617869 13:77561359-77561381 CCTCATGGTGGCCAACATTGTGG + Intronic
1117984541 14:61374449-61374471 CCTCATGGTGAACCTCTATGAGG - Intronic
1119668481 14:76500837-76500859 CCTCATGGACACCAACCATCAGG - Exonic
1119714941 14:76852531-76852553 CCTCATGGTCACCATCAATGAGG + Intronic
1120029048 14:79619473-79619495 TCTCATGGTCACAAGCAATGGGG - Intronic
1123815122 15:23970197-23970219 CCTCATGGTCACCTCTAAAGAGG - Intergenic
1124820945 15:33044982-33045004 CCTCCTTGTCACCCACAATGTGG - Intronic
1125007022 15:34828352-34828374 CATCATCATCATCATCAATGTGG + Intergenic
1127286807 15:57539921-57539943 ACTCCTGGCCACCACCAATGAGG - Intronic
1127896376 15:63303269-63303291 CGTCATGGTCACCCTCAGTGGGG - Intronic
1127896484 15:63304240-63304262 CGTCATGGTCACCCTCAGTGGGG + Intronic
1129217074 15:74106644-74106666 CCCCATGGTGACCATGAATGGGG + Intronic
1129239674 15:74244071-74244093 CATCATGGTCACCCTCCATGGGG + Exonic
1129389255 15:75212496-75212518 ATGCATGGTCACCAGCAATGGGG - Intergenic
1129458500 15:75688370-75688392 CATCTGGGTCACCACCAATGTGG + Exonic
1129734227 15:77950947-77950969 CCCCATGGTGACCAGGAATGGGG + Intergenic
1129841356 15:78745044-78745066 CCCCATGGTGACCAGGAATGGGG - Intergenic
1132798627 16:1740570-1740592 CCACATGCTGACCATCCATGTGG + Intronic
1133266589 16:4588259-4588281 CTTCAAGGTCACGATCCATGAGG + Exonic
1133479414 16:6155552-6155574 CCTTCTGGTCACTATCGATGTGG - Intronic
1134109573 16:11506778-11506800 TCTCCTGCCCACCATCAATGGGG + Intronic
1134681863 16:16131905-16131927 CATCAATGTCACGATCAATGGGG + Exonic
1138072567 16:54007712-54007734 CCTTAGGGTCACAATCAATGGGG - Intronic
1139196425 16:64924051-64924073 CCTAAATGTCACCATTAATGGGG + Intergenic
1149416593 17:56466424-56466446 ACTCATAGTCACCATCAGGGAGG + Exonic
1151101294 17:71558438-71558460 TCTCTTGCTCATCATCAATGAGG + Intergenic
1151383474 17:73741255-73741277 CCTCATCGCCGCCATGAATGAGG - Intergenic
1152101969 17:78307029-78307051 CCTCATGGGCTTCCTCAATGTGG + Intergenic
1152446103 17:80345163-80345185 GCACATGGTCACCATGGATGGGG + Exonic
1156571761 18:38263694-38263716 CCTCATGGTAATCATCTTTGAGG + Intergenic
1157136660 18:45063419-45063441 CATCATGGCCACCATCGAGGCGG + Exonic
1158212463 18:55066640-55066662 CCTCCTGGTCAGCCTCTATGTGG + Intergenic
1160857601 19:1224402-1224424 CCTCATGGTGCCCATCCTTGGGG + Intronic
1162138492 19:8571010-8571032 GCTCATGGCCACCATTGATGGGG - Intronic
1163494253 19:17636058-17636080 CCTCATAGTGTCCATCATTGAGG - Exonic
1163685875 19:18711332-18711354 CCTCATGCTCCCCTTCAAAGCGG - Intronic
1164419569 19:28077089-28077111 TTTCATGGTCACCATCAAGGAGG - Intergenic
1164776755 19:30858828-30858850 TCTCATGGCCACAATGAATGTGG - Intergenic
1166083991 19:40463162-40463184 CCTCAGTTTCCCCATCAATGTGG - Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
1202678575 1_KI270711v1_random:29851-29873 CCTGAGGGTCACCACCAATGGGG + Intergenic
928055716 2:28052100-28052122 CCTCATGAACACCAACAATCTGG - Intronic
929093727 2:38244760-38244782 CCTAATGCTCACTATCACTGTGG - Intergenic
929807360 2:45158706-45158728 CCTGATGGTAACCATCTTTGAGG - Intergenic
930957338 2:57218114-57218136 CCTCCTTGTCACCCACAATGTGG - Intergenic
931005749 2:57849200-57849222 CCTTCTTGTCACCCTCAATGTGG + Intergenic
932459511 2:71873219-71873241 CCTCAGAGTCTCCATCATTGTGG + Intergenic
932460142 2:71876566-71876588 CCGCATGGACACCTCCAATGTGG - Intergenic
932988812 2:76761382-76761404 CCTCTTAGTTACCATCAATTTGG + Intronic
934854537 2:97720802-97720824 CCTCACTGTCACAATCAATCGGG + Intronic
939037956 2:137155691-137155713 CCAAATGGTCCCCATCAAGGAGG - Intronic
942660885 2:178264038-178264060 CTTCCTGGTCACCCACAATGGGG + Intronic
943345560 2:186733940-186733962 CCTTCTTGTCACCAGCAATGTGG + Intronic
945659609 2:212669448-212669470 CCTCATTTTCACCATCCAAGTGG - Intergenic
946762740 2:223011174-223011196 CCACATGGACAACATCTATGGGG + Intergenic
947467233 2:230362043-230362065 GCCCATGGTCAACATCAAAGAGG + Intronic
948842769 2:240663621-240663643 CCTCAAGGTCAACATCAACAGGG - Intergenic
1170715173 20:18824908-18824930 CCTGATGGTGACCATCAAGATGG + Intronic
1171386185 20:24770737-24770759 CCCCATGGGCACCATCAGGGAGG + Intergenic
1174176993 20:48651512-48651534 CCCCATGGTCACCCTGACTGTGG - Exonic
1175752281 20:61507633-61507655 CATCAAGGTCACCAAAAATGAGG + Intronic
1180628498 22:17210497-17210519 CCTCATGGTGACCTTTAATTTGG - Intronic
1180876553 22:19177723-19177745 CCCCATGGAGACCATCAAGGTGG - Exonic
1181945087 22:26510215-26510237 CGTCATCATCATCATCAATGCGG + Exonic
1184227041 22:43135034-43135056 GCTCAAGGTCACCATCACAGGGG + Intronic
952731175 3:36637865-36637887 CCTGAGGGTCACCACCGATGGGG + Intergenic
966595752 3:181723556-181723578 CCGCATGGACACCAGGAATGCGG + Intergenic
969923812 4:10566090-10566112 CATCATAGTCATCATCACTGTGG + Exonic
971626656 4:28929451-28929473 CCTCATTGTCAAGATAAATGTGG - Intergenic
977887457 4:102269451-102269473 CATCATTGTCATCACCAATGTGG + Intronic
978044758 4:104112981-104113003 CCTTTTGGGCACCTTCAATGAGG + Intergenic
980960819 4:139472979-139473001 CCACATGGTCATTATCATTGGGG - Exonic
984878302 4:184388925-184388947 CCTCCAGGTCACCATCAAAGAGG - Exonic
985635709 5:1034767-1034789 CCTCATGCACACCATCTATGAGG + Exonic
986480254 5:8179749-8179771 CCTCATGGTTAACATCATTCTGG + Intergenic
987216099 5:15738942-15738964 CCACATTGTCACCAGCACTGAGG + Intronic
987237502 5:15957723-15957745 CCTCATGGTGACAATCCAGGAGG + Intergenic
987331590 5:16862068-16862090 CCTCATCCTCACCAACTATGAGG + Intronic
987403122 5:17498389-17498411 CCTCATTGTCACCTTCTGTGAGG - Intergenic
987805962 5:22769083-22769105 CCTCTTAGTAACCATCACTGGGG - Intronic
993617953 5:90136387-90136409 CCTTTTGGTCACCCACAATGTGG + Intergenic
998747123 5:145273459-145273481 CCCCATCATCACCATCTATGGGG - Intergenic
998988535 5:147789354-147789376 CCTCATTGTCCTCATCTATGAGG + Intergenic
999361362 5:150989172-150989194 CCTCATGGTCCCCATAAAATGGG - Intergenic
1000863860 5:166488886-166488908 CCTCAGGGTCTCCATGATTGTGG + Intergenic
1003578825 6:7321042-7321064 CCTAATGGTCAGCAACAATGTGG + Intronic
1005912342 6:30322131-30322153 CCTCATGGTCAACTTCAGTAAGG - Intergenic
1007803587 6:44419460-44419482 CCTCATGGCCCTCACCAATGTGG + Exonic
1012519101 6:100098921-100098943 GCTCAGGGTCCCCATCAAGGTGG + Intergenic
1017017921 6:150116468-150116490 CCTTATTGACACCATGAATGGGG - Intergenic
1018343371 6:162876138-162876160 ATTCATGGTCACCATCATAGGGG + Intronic
1018629351 6:165808984-165809006 CCTCTTGGGCACCATTAAGGAGG + Intronic
1018728874 6:166634261-166634283 CCTCTTGCTCTCCATCACTGTGG - Intronic
1021164376 7:17317626-17317648 CCTCATTCTCAGCATCACTGGGG + Intronic
1025004259 7:55342833-55342855 CCTCCTGGGCACCATCTTTGCGG - Intergenic
1026309307 7:69170054-69170076 CCTCATTGTCACCATCGTTATGG - Intergenic
1026393711 7:69928930-69928952 CACCATTGCCACCATCAATGTGG + Intronic
1030752127 7:113241414-113241436 CCTGAGGGTCCCCAGCAATGTGG + Intergenic
1035824864 8:2633716-2633738 CCACATGGTCACCACCAGTGGGG - Intergenic
1037778796 8:21853515-21853537 CCCCTTGGTGTCCATCAATGAGG - Intergenic
1039408983 8:37336157-37336179 CCTGATGCACACCATCAATTTGG - Intergenic
1040472203 8:47743453-47743475 CTTCATGGCCACCAACAATCTGG - Intergenic
1046164175 8:110407803-110407825 CCACATGGTCAGTATCAAAGTGG + Intergenic
1051158177 9:14174421-14174443 CCTAATGGACACAATAAATGAGG + Intronic
1055234621 9:74105668-74105690 CCACATTGCCATCATCAATGTGG + Intergenic
1055645520 9:78358170-78358192 TCTCCTTGTCACCCTCAATGTGG - Intergenic
1056816514 9:89805716-89805738 ACTCCTGGGCACCATCAGTGTGG + Intergenic
1202801203 9_KI270720v1_random:784-806 TCTCATAGTCACCATCAACATGG + Intergenic
1186373170 X:8967570-8967592 CCTCCTGGTGACCATCAAATGGG - Intergenic
1188920810 X:35974413-35974435 CCTCATGGCCACCTTAACTGTGG - Intronic
1190305680 X:49080170-49080192 CCCCTTGGTCACCCACAATGGGG + Intronic
1190369572 X:49727782-49727804 CCTCCTTGTCACCCGCAATGTGG - Intergenic
1191225979 X:58043653-58043675 CCTCATGGACAACCTCTATGAGG - Intergenic
1200687686 Y:6271937-6271959 CCTCATCCTCACCAGAAATGAGG + Intergenic
1201047584 Y:9902766-9902788 CCTCATCCTCACCAGAAATGAGG - Intergenic