ID: 1119719694

View in Genome Browser
Species Human (GRCh38)
Location 14:76882706-76882728
Sequence CAGGGGAAGCAGAAGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119719694_1119719696 -7 Left 1119719694 14:76882706-76882728 CCTGCCTGCTTCTGCTTCCCCTG No data
Right 1119719696 14:76882722-76882744 TCCCCTGACTTCAGCCCAGCTGG No data
1119719694_1119719700 -5 Left 1119719694 14:76882706-76882728 CCTGCCTGCTTCTGCTTCCCCTG No data
Right 1119719700 14:76882724-76882746 CCCTGACTTCAGCCCAGCTGGGG No data
1119719694_1119719698 -6 Left 1119719694 14:76882706-76882728 CCTGCCTGCTTCTGCTTCCCCTG No data
Right 1119719698 14:76882723-76882745 CCCCTGACTTCAGCCCAGCTGGG No data
1119719694_1119719704 19 Left 1119719694 14:76882706-76882728 CCTGCCTGCTTCTGCTTCCCCTG No data
Right 1119719704 14:76882748-76882770 TGCCAGAGTCAAGCAAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119719694 Original CRISPR CAGGGGAAGCAGAAGCAGGC AGG (reversed) Intergenic
No off target data available for this crispr