ID: 1119721028

View in Genome Browser
Species Human (GRCh38)
Location 14:76890583-76890605
Sequence CAGTGATCCAAGAGGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119721022_1119721028 16 Left 1119721022 14:76890544-76890566 CCATGGTGCTGCTTGCAACATGG No data
Right 1119721028 14:76890583-76890605 CAGTGATCCAAGAGGGAACATGG No data
1119721018_1119721028 30 Left 1119721018 14:76890530-76890552 CCCCATGGGCCTCTCCATGGTGC No data
Right 1119721028 14:76890583-76890605 CAGTGATCCAAGAGGGAACATGG No data
1119721019_1119721028 29 Left 1119721019 14:76890531-76890553 CCCATGGGCCTCTCCATGGTGCT No data
Right 1119721028 14:76890583-76890605 CAGTGATCCAAGAGGGAACATGG No data
1119721020_1119721028 28 Left 1119721020 14:76890532-76890554 CCATGGGCCTCTCCATGGTGCTG No data
Right 1119721028 14:76890583-76890605 CAGTGATCCAAGAGGGAACATGG No data
1119721021_1119721028 21 Left 1119721021 14:76890539-76890561 CCTCTCCATGGTGCTGCTTGCAA No data
Right 1119721028 14:76890583-76890605 CAGTGATCCAAGAGGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119721028 Original CRISPR CAGTGATCCAAGAGGGAACA TGG Intergenic
No off target data available for this crispr