ID: 1119722333

View in Genome Browser
Species Human (GRCh38)
Location 14:76899651-76899673
Sequence AAGAGTGAGGAGGGCGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119722326_1119722333 12 Left 1119722326 14:76899616-76899638 CCCATCAGATGGGTGGCTTTGCC No data
Right 1119722333 14:76899651-76899673 AAGAGTGAGGAGGGCGGTGAAGG No data
1119722320_1119722333 23 Left 1119722320 14:76899605-76899627 CCCCAGGCTATCCCATCAGATGG No data
Right 1119722333 14:76899651-76899673 AAGAGTGAGGAGGGCGGTGAAGG No data
1119722327_1119722333 11 Left 1119722327 14:76899617-76899639 CCATCAGATGGGTGGCTTTGCCT No data
Right 1119722333 14:76899651-76899673 AAGAGTGAGGAGGGCGGTGAAGG No data
1119722328_1119722333 -9 Left 1119722328 14:76899637-76899659 CCTGCAGCTAGAACAAGAGTGAG No data
Right 1119722333 14:76899651-76899673 AAGAGTGAGGAGGGCGGTGAAGG No data
1119722324_1119722333 21 Left 1119722324 14:76899607-76899629 CCAGGCTATCCCATCAGATGGGT No data
Right 1119722333 14:76899651-76899673 AAGAGTGAGGAGGGCGGTGAAGG No data
1119722322_1119722333 22 Left 1119722322 14:76899606-76899628 CCCAGGCTATCCCATCAGATGGG No data
Right 1119722333 14:76899651-76899673 AAGAGTGAGGAGGGCGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119722333 Original CRISPR AAGAGTGAGGAGGGCGGTGA AGG Intergenic
No off target data available for this crispr