ID: 1119728889

View in Genome Browser
Species Human (GRCh38)
Location 14:76938631-76938653
Sequence TCCTCCAGGGACTGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119728874_1119728889 18 Left 1119728874 14:76938590-76938612 CCCACCCTGCTGGGGAGCCTCAG No data
Right 1119728889 14:76938631-76938653 TCCTCCAGGGACTGGCAGGAGGG No data
1119728878_1119728889 13 Left 1119728878 14:76938595-76938617 CCTGCTGGGGAGCCTCAGAGGCA No data
Right 1119728889 14:76938631-76938653 TCCTCCAGGGACTGGCAGGAGGG No data
1119728877_1119728889 14 Left 1119728877 14:76938594-76938616 CCCTGCTGGGGAGCCTCAGAGGC No data
Right 1119728889 14:76938631-76938653 TCCTCCAGGGACTGGCAGGAGGG No data
1119728879_1119728889 1 Left 1119728879 14:76938607-76938629 CCTCAGAGGCACACTCCCCTCCT No data
Right 1119728889 14:76938631-76938653 TCCTCCAGGGACTGGCAGGAGGG No data
1119728875_1119728889 17 Left 1119728875 14:76938591-76938613 CCACCCTGCTGGGGAGCCTCAGA No data
Right 1119728889 14:76938631-76938653 TCCTCCAGGGACTGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119728889 Original CRISPR TCCTCCAGGGACTGGCAGGA GGG Intergenic
No off target data available for this crispr