ID: 1119730586

View in Genome Browser
Species Human (GRCh38)
Location 14:76948547-76948569
Sequence GAATCTAACCCGAAGCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119730586_1119730596 11 Left 1119730586 14:76948547-76948569 CCCCTTGGCTTCGGGTTAGATTC No data
Right 1119730596 14:76948581-76948603 TAAGGTGGCAGGTGACTGGAGGG No data
1119730586_1119730591 -4 Left 1119730586 14:76948547-76948569 CCCCTTGGCTTCGGGTTAGATTC No data
Right 1119730591 14:76948566-76948588 ATTCAGCCAATGGAATAAGGTGG No data
1119730586_1119730598 27 Left 1119730586 14:76948547-76948569 CCCCTTGGCTTCGGGTTAGATTC No data
Right 1119730598 14:76948597-76948619 TGGAGGGCAGAAGGATAAAGAGG No data
1119730586_1119730590 -7 Left 1119730586 14:76948547-76948569 CCCCTTGGCTTCGGGTTAGATTC No data
Right 1119730590 14:76948563-76948585 TAGATTCAGCCAATGGAATAAGG No data
1119730586_1119730594 7 Left 1119730586 14:76948547-76948569 CCCCTTGGCTTCGGGTTAGATTC No data
Right 1119730594 14:76948577-76948599 GGAATAAGGTGGCAGGTGACTGG No data
1119730586_1119730595 10 Left 1119730586 14:76948547-76948569 CCCCTTGGCTTCGGGTTAGATTC No data
Right 1119730595 14:76948580-76948602 ATAAGGTGGCAGGTGACTGGAGG No data
1119730586_1119730592 0 Left 1119730586 14:76948547-76948569 CCCCTTGGCTTCGGGTTAGATTC No data
Right 1119730592 14:76948570-76948592 AGCCAATGGAATAAGGTGGCAGG No data
1119730586_1119730597 18 Left 1119730586 14:76948547-76948569 CCCCTTGGCTTCGGGTTAGATTC No data
Right 1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119730586 Original CRISPR GAATCTAACCCGAAGCCAAG GGG (reversed) Intergenic
No off target data available for this crispr