ID: 1119730590

View in Genome Browser
Species Human (GRCh38)
Location 14:76948563-76948585
Sequence TAGATTCAGCCAATGGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119730580_1119730590 29 Left 1119730580 14:76948511-76948533 CCTGACCTCTCAGGACTGTGCCA No data
Right 1119730590 14:76948563-76948585 TAGATTCAGCCAATGGAATAAGG No data
1119730588_1119730590 -9 Left 1119730588 14:76948549-76948571 CCTTGGCTTCGGGTTAGATTCAG No data
Right 1119730590 14:76948563-76948585 TAGATTCAGCCAATGGAATAAGG No data
1119730581_1119730590 24 Left 1119730581 14:76948516-76948538 CCTCTCAGGACTGTGCCACAGAG No data
Right 1119730590 14:76948563-76948585 TAGATTCAGCCAATGGAATAAGG No data
1119730586_1119730590 -7 Left 1119730586 14:76948547-76948569 CCCCTTGGCTTCGGGTTAGATTC No data
Right 1119730590 14:76948563-76948585 TAGATTCAGCCAATGGAATAAGG No data
1119730579_1119730590 30 Left 1119730579 14:76948510-76948532 CCCTGACCTCTCAGGACTGTGCC No data
Right 1119730590 14:76948563-76948585 TAGATTCAGCCAATGGAATAAGG No data
1119730582_1119730590 9 Left 1119730582 14:76948531-76948553 CCACAGAGCGTTCTTACCCCTTG No data
Right 1119730590 14:76948563-76948585 TAGATTCAGCCAATGGAATAAGG No data
1119730587_1119730590 -8 Left 1119730587 14:76948548-76948570 CCCTTGGCTTCGGGTTAGATTCA No data
Right 1119730590 14:76948563-76948585 TAGATTCAGCCAATGGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119730590 Original CRISPR TAGATTCAGCCAATGGAATA AGG Intergenic
No off target data available for this crispr