ID: 1119730591

View in Genome Browser
Species Human (GRCh38)
Location 14:76948566-76948588
Sequence ATTCAGCCAATGGAATAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119730587_1119730591 -5 Left 1119730587 14:76948548-76948570 CCCTTGGCTTCGGGTTAGATTCA No data
Right 1119730591 14:76948566-76948588 ATTCAGCCAATGGAATAAGGTGG No data
1119730581_1119730591 27 Left 1119730581 14:76948516-76948538 CCTCTCAGGACTGTGCCACAGAG No data
Right 1119730591 14:76948566-76948588 ATTCAGCCAATGGAATAAGGTGG No data
1119730582_1119730591 12 Left 1119730582 14:76948531-76948553 CCACAGAGCGTTCTTACCCCTTG No data
Right 1119730591 14:76948566-76948588 ATTCAGCCAATGGAATAAGGTGG No data
1119730586_1119730591 -4 Left 1119730586 14:76948547-76948569 CCCCTTGGCTTCGGGTTAGATTC No data
Right 1119730591 14:76948566-76948588 ATTCAGCCAATGGAATAAGGTGG No data
1119730588_1119730591 -6 Left 1119730588 14:76948549-76948571 CCTTGGCTTCGGGTTAGATTCAG No data
Right 1119730591 14:76948566-76948588 ATTCAGCCAATGGAATAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119730591 Original CRISPR ATTCAGCCAATGGAATAAGG TGG Intergenic
No off target data available for this crispr