ID: 1119730593

View in Genome Browser
Species Human (GRCh38)
Location 14:76948572-76948594
Sequence CACCTGCCACCTTATTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119730593_1119730597 -7 Left 1119730593 14:76948572-76948594 CCAATGGAATAAGGTGGCAGGTG No data
Right 1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG No data
1119730593_1119730598 2 Left 1119730593 14:76948572-76948594 CCAATGGAATAAGGTGGCAGGTG No data
Right 1119730598 14:76948597-76948619 TGGAGGGCAGAAGGATAAAGAGG No data
1119730593_1119730599 6 Left 1119730593 14:76948572-76948594 CCAATGGAATAAGGTGGCAGGTG No data
Right 1119730599 14:76948601-76948623 GGGCAGAAGGATAAAGAGGTCGG No data
1119730593_1119730600 7 Left 1119730593 14:76948572-76948594 CCAATGGAATAAGGTGGCAGGTG No data
Right 1119730600 14:76948602-76948624 GGCAGAAGGATAAAGAGGTCGGG No data
1119730593_1119730601 8 Left 1119730593 14:76948572-76948594 CCAATGGAATAAGGTGGCAGGTG No data
Right 1119730601 14:76948603-76948625 GCAGAAGGATAAAGAGGTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119730593 Original CRISPR CACCTGCCACCTTATTCCAT TGG (reversed) Intergenic
No off target data available for this crispr