ID: 1119730599

View in Genome Browser
Species Human (GRCh38)
Location 14:76948601-76948623
Sequence GGGCAGAAGGATAAAGAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119730587_1119730599 30 Left 1119730587 14:76948548-76948570 CCCTTGGCTTCGGGTTAGATTCA No data
Right 1119730599 14:76948601-76948623 GGGCAGAAGGATAAAGAGGTCGG No data
1119730593_1119730599 6 Left 1119730593 14:76948572-76948594 CCAATGGAATAAGGTGGCAGGTG No data
Right 1119730599 14:76948601-76948623 GGGCAGAAGGATAAAGAGGTCGG No data
1119730588_1119730599 29 Left 1119730588 14:76948549-76948571 CCTTGGCTTCGGGTTAGATTCAG No data
Right 1119730599 14:76948601-76948623 GGGCAGAAGGATAAAGAGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119730599 Original CRISPR GGGCAGAAGGATAAAGAGGT CGG Intergenic
No off target data available for this crispr