ID: 1119730841

View in Genome Browser
Species Human (GRCh38)
Location 14:76950286-76950308
Sequence GTGTGTAGGGGGCAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119730826_1119730841 24 Left 1119730826 14:76950239-76950261 CCTTGGCTCGTCCGGGGCTGGAG No data
Right 1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG No data
1119730828_1119730841 13 Left 1119730828 14:76950250-76950272 CCGGGGCTGGAGGAATGCAGCTC No data
Right 1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119730841 Original CRISPR GTGTGTAGGGGGCAGGTGGT GGG Intergenic
No off target data available for this crispr