ID: 1119732255

View in Genome Browser
Species Human (GRCh38)
Location 14:76958356-76958378
Sequence GCTGCCAGTCAGGCACTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119732249_1119732255 10 Left 1119732249 14:76958323-76958345 CCGACAGGTGGCTGAGAGAACCC No data
Right 1119732255 14:76958356-76958378 GCTGCCAGTCAGGCACTCCCTGG No data
1119732247_1119732255 24 Left 1119732247 14:76958309-76958331 CCAAGGTCACAGGACCGACAGGT No data
Right 1119732255 14:76958356-76958378 GCTGCCAGTCAGGCACTCCCTGG No data
1119732251_1119732255 -10 Left 1119732251 14:76958343-76958365 CCCTGGCATTCCAGCTGCCAGTC No data
Right 1119732255 14:76958356-76958378 GCTGCCAGTCAGGCACTCCCTGG No data
1119732245_1119732255 25 Left 1119732245 14:76958308-76958330 CCCAAGGTCACAGGACCGACAGG No data
Right 1119732255 14:76958356-76958378 GCTGCCAGTCAGGCACTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119732255 Original CRISPR GCTGCCAGTCAGGCACTCCC TGG Intergenic
No off target data available for this crispr