ID: 1119735241

View in Genome Browser
Species Human (GRCh38)
Location 14:76977446-76977468
Sequence CAGACCCTGGAGGAGTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119735241_1119735246 -1 Left 1119735241 14:76977446-76977468 CCAGACCACTCCTCCAGGGTCTG No data
Right 1119735246 14:76977468-76977490 GCCTCAGTATAGCTGAGGTCAGG No data
1119735241_1119735249 5 Left 1119735241 14:76977446-76977468 CCAGACCACTCCTCCAGGGTCTG No data
Right 1119735249 14:76977474-76977496 GTATAGCTGAGGTCAGGCCTGGG No data
1119735241_1119735245 -6 Left 1119735241 14:76977446-76977468 CCAGACCACTCCTCCAGGGTCTG No data
Right 1119735245 14:76977463-76977485 GGTCTGCCTCAGTATAGCTGAGG No data
1119735241_1119735248 4 Left 1119735241 14:76977446-76977468 CCAGACCACTCCTCCAGGGTCTG No data
Right 1119735248 14:76977473-76977495 AGTATAGCTGAGGTCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119735241 Original CRISPR CAGACCCTGGAGGAGTGGTC TGG (reversed) Intergenic
No off target data available for this crispr