ID: 1119738074

View in Genome Browser
Species Human (GRCh38)
Location 14:76996638-76996660
Sequence GGATTCTGCTGGGGTCAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119738074_1119738084 14 Left 1119738074 14:76996638-76996660 CCTTTTTGACCCCAGCAGAATCC No data
Right 1119738084 14:76996675-76996697 AGGAGCAAAAAAATATAAAAAGG No data
1119738074_1119738078 -6 Left 1119738074 14:76996638-76996660 CCTTTTTGACCCCAGCAGAATCC No data
Right 1119738078 14:76996655-76996677 GAATCCTGCTTCCCTTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119738074 Original CRISPR GGATTCTGCTGGGGTCAAAA AGG (reversed) Intergenic
No off target data available for this crispr