ID: 1119740776

View in Genome Browser
Species Human (GRCh38)
Location 14:77012448-77012470
Sequence GTGGTGAAGCCGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119740776_1119740787 27 Left 1119740776 14:77012448-77012470 CCCTCCTCCTTCGGCTTCACCAC No data
Right 1119740787 14:77012498-77012520 CCTAGCTGGTTTCTCAATCTTGG No data
1119740776_1119740784 13 Left 1119740776 14:77012448-77012470 CCCTCCTCCTTCGGCTTCACCAC No data
Right 1119740784 14:77012484-77012506 AACTGCAATCGCCTCCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119740776 Original CRISPR GTGGTGAAGCCGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr