ID: 1119743678

View in Genome Browser
Species Human (GRCh38)
Location 14:77029291-77029313
Sequence TAGCTCTATCGTTGAAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119743678_1119743687 30 Left 1119743678 14:77029291-77029313 CCCGGGCTTCAACGATAGAGCTA No data
Right 1119743687 14:77029344-77029366 CAGCCGCACTTTAAAAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119743678 Original CRISPR TAGCTCTATCGTTGAAGCCC GGG (reversed) Intergenic
No off target data available for this crispr