ID: 1119744509

View in Genome Browser
Species Human (GRCh38)
Location 14:77034223-77034245
Sequence GCCAAAATATTTGAAGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119744509_1119744512 20 Left 1119744509 14:77034223-77034245 CCAGGATCTTCAAATATTTTGGC No data
Right 1119744512 14:77034266-77034288 AACCCGAAACTCAGGAGAGAGGG No data
1119744509_1119744517 28 Left 1119744509 14:77034223-77034245 CCAGGATCTTCAAATATTTTGGC No data
Right 1119744517 14:77034274-77034296 ACTCAGGAGAGAGGGAGGAAGGG No data
1119744509_1119744516 27 Left 1119744509 14:77034223-77034245 CCAGGATCTTCAAATATTTTGGC No data
Right 1119744516 14:77034273-77034295 AACTCAGGAGAGAGGGAGGAAGG No data
1119744509_1119744510 12 Left 1119744509 14:77034223-77034245 CCAGGATCTTCAAATATTTTGGC No data
Right 1119744510 14:77034258-77034280 AGTAGTTCAACCCGAAACTCAGG No data
1119744509_1119744515 23 Left 1119744509 14:77034223-77034245 CCAGGATCTTCAAATATTTTGGC No data
Right 1119744515 14:77034269-77034291 CCGAAACTCAGGAGAGAGGGAGG No data
1119744509_1119744511 19 Left 1119744509 14:77034223-77034245 CCAGGATCTTCAAATATTTTGGC No data
Right 1119744511 14:77034265-77034287 CAACCCGAAACTCAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119744509 Original CRISPR GCCAAAATATTTGAAGATCC TGG (reversed) Intergenic
No off target data available for this crispr