ID: 1119744511

View in Genome Browser
Species Human (GRCh38)
Location 14:77034265-77034287
Sequence CAACCCGAAACTCAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119744509_1119744511 19 Left 1119744509 14:77034223-77034245 CCAGGATCTTCAAATATTTTGGC No data
Right 1119744511 14:77034265-77034287 CAACCCGAAACTCAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119744511 Original CRISPR CAACCCGAAACTCAGGAGAG AGG Intergenic
No off target data available for this crispr