ID: 1119745074

View in Genome Browser
Species Human (GRCh38)
Location 14:77038263-77038285
Sequence GCCTCTACTAGGGTTAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119745055_1119745074 27 Left 1119745055 14:77038213-77038235 CCACGCGCCCCAAGGAGGGGCAC No data
Right 1119745074 14:77038263-77038285 GCCTCTACTAGGGTTAGCTGGGG No data
1119745069_1119745074 -5 Left 1119745069 14:77038245-77038267 CCGGCGGGTGGGGGGGCGGCCTC No data
Right 1119745074 14:77038263-77038285 GCCTCTACTAGGGTTAGCTGGGG No data
1119745056_1119745074 20 Left 1119745056 14:77038220-77038242 CCCCAAGGAGGGGCACTTGCATT No data
Right 1119745074 14:77038263-77038285 GCCTCTACTAGGGTTAGCTGGGG No data
1119745057_1119745074 19 Left 1119745057 14:77038221-77038243 CCCAAGGAGGGGCACTTGCATTT No data
Right 1119745074 14:77038263-77038285 GCCTCTACTAGGGTTAGCTGGGG No data
1119745058_1119745074 18 Left 1119745058 14:77038222-77038244 CCAAGGAGGGGCACTTGCATTTT No data
Right 1119745074 14:77038263-77038285 GCCTCTACTAGGGTTAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119745074 Original CRISPR GCCTCTACTAGGGTTAGCTG GGG Intergenic
No off target data available for this crispr