ID: 1119746034

View in Genome Browser
Species Human (GRCh38)
Location 14:77044798-77044820
Sequence CTGTAAACAGAGAAGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119746034_1119746035 6 Left 1119746034 14:77044798-77044820 CCTTGCTGCTTCTCTGTTTACAG No data
Right 1119746035 14:77044827-77044849 GCCAGCCTTCAGCTGTCATTAGG No data
1119746034_1119746037 7 Left 1119746034 14:77044798-77044820 CCTTGCTGCTTCTCTGTTTACAG No data
Right 1119746037 14:77044828-77044850 CCAGCCTTCAGCTGTCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119746034 Original CRISPR CTGTAAACAGAGAAGCAGCA AGG (reversed) Intergenic
No off target data available for this crispr