ID: 1119750001

View in Genome Browser
Species Human (GRCh38)
Location 14:77070445-77070467
Sequence GGCCCCCTTTAGGCTCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119750001_1119750009 21 Left 1119750001 14:77070445-77070467 CCCAGCAGAGCCTAAAGGGGGCC 0: 1
1: 0
2: 3
3: 17
4: 179
Right 1119750009 14:77070489-77070511 TCTTCAAATCACACTCCCTGTGG 0: 1
1: 0
2: 1
3: 22
4: 170
1119750001_1119750010 24 Left 1119750001 14:77070445-77070467 CCCAGCAGAGCCTAAAGGGGGCC 0: 1
1: 0
2: 3
3: 17
4: 179
Right 1119750010 14:77070492-77070514 TCAAATCACACTCCCTGTGGTGG 0: 1
1: 0
2: 2
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119750001 Original CRISPR GGCCCCCTTTAGGCTCTGCT GGG (reversed) Intergenic