ID: 1119750001

View in Genome Browser
Species Human (GRCh38)
Location 14:77070445-77070467
Sequence GGCCCCCTTTAGGCTCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119750001_1119750010 24 Left 1119750001 14:77070445-77070467 CCCAGCAGAGCCTAAAGGGGGCC 0: 1
1: 0
2: 3
3: 17
4: 179
Right 1119750010 14:77070492-77070514 TCAAATCACACTCCCTGTGGTGG 0: 1
1: 0
2: 2
3: 14
4: 167
1119750001_1119750009 21 Left 1119750001 14:77070445-77070467 CCCAGCAGAGCCTAAAGGGGGCC 0: 1
1: 0
2: 3
3: 17
4: 179
Right 1119750009 14:77070489-77070511 TCTTCAAATCACACTCCCTGTGG 0: 1
1: 0
2: 1
3: 22
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119750001 Original CRISPR GGCCCCCTTTAGGCTCTGCT GGG (reversed) Intergenic
902564829 1:17304568-17304590 GGTCCCCTTTGGGCTCTGAAAGG + Intergenic
902577208 1:17386013-17386035 GGCTCCCTCCAGCCTCTGCTGGG - Intronic
902753755 1:18535956-18535978 GGCCCCATCTGGGCTCTGCAGGG + Intergenic
903164391 1:21510164-21510186 CGCCCCCTTTAGGCTTTGCGAGG + Intronic
903296973 1:22350233-22350255 GGCCTCCCTTCTGCTCTGCTCGG + Intergenic
905633403 1:39531693-39531715 GGCCCACCTTAGGGTCAGCTTGG - Intergenic
907315402 1:53567711-53567733 GGCCCCTTTTAGCCACAGCTGGG - Intronic
910001780 1:82350375-82350397 GGCCCACTTTAGCCACAGCTGGG + Intergenic
912327830 1:108785399-108785421 GGCCCCTTTTAGCCACAGCTGGG + Intronic
918549673 1:185727721-185727743 GCCACTCTTTAGGCTCAGCTGGG - Intergenic
918579795 1:186112517-186112539 GTCCTCCTCTAGACTCTGCTGGG - Intronic
919125555 1:193388756-193388778 GGCCCCTTTTAGCCACCGCTGGG + Intergenic
919376063 1:196796240-196796262 GGCCCCTTTTAGCCCCTGCTGGG - Intergenic
919385767 1:196921129-196921151 GGCCCCTTTTAGCCCCTGCTGGG - Intronic
924670083 1:246115020-246115042 GGCCTCCTTCAGGCTCCGCCTGG - Intronic
1065236376 10:23657054-23657076 GGCCCACTTTTGGCTCTAGTGGG - Intergenic
1070667704 10:78357110-78357132 GGCCCCATCTAGCCTCTGATGGG + Intergenic
1070753770 10:78979015-78979037 AGCCACCCTTAGGCTCCGCTTGG - Intergenic
1073115433 10:101089038-101089060 GGGCACCTTTAGGGACTGCTGGG + Intergenic
1073288876 10:102403571-102403593 TGCCCCCTCTGGGCTCTCCTGGG + Intronic
1074261436 10:111857423-111857445 GGCCTCCTTTAGGCTCCTCTTGG + Intergenic
1075794608 10:125110140-125110162 AGTCCCCTCAAGGCTCTGCTAGG + Intronic
1078514951 11:12014115-12014137 GGCCCCTTTTAGCCACAGCTGGG - Intergenic
1078770639 11:14348099-14348121 GGTCCCCTTTATGCTCTGCTTGG + Intronic
1080240509 11:30122029-30122051 AGCCCCTTTTAGGATCTTCTTGG + Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1080978973 11:37377434-37377456 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
1082981872 11:59131627-59131649 GGCCCCTTTTAGCCACAGCTGGG - Intergenic
1083160791 11:60852945-60852967 GGCCGCCTTCGCGCTCTGCTGGG - Exonic
1084209766 11:67615537-67615559 GGCACCCACTTGGCTCTGCTTGG - Intergenic
1084723735 11:70926707-70926729 GGCCCCATTCAGCCTCAGCTGGG + Intronic
1085215541 11:74827270-74827292 GGCCCCTTTTAGCCACGGCTGGG + Intronic
1087571104 11:99928593-99928615 GGCCCCTTTTAGCCACAGCTGGG + Intronic
1089735438 11:120547428-120547450 GGGCTCCTTTAGACTCTGGTCGG + Intronic
1091555554 12:1570572-1570594 GGTTCCCTGTAGGCTCTCCTGGG + Intronic
1091715720 12:2774808-2774830 GGACCCCTTTAGTCTCTCCCTGG - Intergenic
1091753527 12:3037377-3037399 TTCCCCCTCTAGGCACTGCTGGG - Intronic
1094830602 12:34298452-34298474 GGCCCCATGTAGGAGCTGCTGGG - Intergenic
1094831213 12:34301141-34301163 GGCCCCCCGTAGGGGCTGCTGGG - Intergenic
1094831312 12:34301562-34301584 GACCCCCTGTAGGTGCTGCTGGG - Intergenic
1098203719 12:68083992-68084014 GGCCCCTTTTAGCCACGGCTGGG + Intergenic
1103443324 12:120979121-120979143 GGGCCCCTCTAGGCTCTCCTGGG - Intronic
1105705139 13:22963672-22963694 GGCTCCCATTAGGGGCTGCTGGG + Intergenic
1105858052 13:24388688-24388710 GGCTCCCATTAGGGGCTGCTGGG + Intergenic
1106424334 13:29611504-29611526 GGCCTCCGATTGGCTCTGCTAGG + Intergenic
1108508981 13:51137602-51137624 GGCCCCCTTTCTGTTGTGCTTGG - Intergenic
1108523176 13:51262992-51263014 GGCCCACTGTAGCCCCTGCTGGG + Intronic
1110616537 13:77548075-77548097 CTGCCCCTTTAGGGTCTGCTAGG + Intronic
1111737883 13:92164960-92164982 GGCCCCTTTTAGCCACAGCTGGG + Intronic
1112029313 13:95442591-95442613 GGCCCCCTTTGGGCTCCACAGGG + Intronic
1112163070 13:96889230-96889252 AGCCCCCTTTAGCCACAGCTGGG + Intergenic
1112861518 13:103833637-103833659 GGCCCCTTTTAGCCACTGCTGGG - Intergenic
1119178531 14:72587824-72587846 GGCCACCCTGAGGCCCTGCTTGG + Intergenic
1119750001 14:77070445-77070467 GGCCCCCTTTAGGCTCTGCTGGG - Intergenic
1119933986 14:78574009-78574031 GGCCCCTTTTAGCCACAGCTGGG - Intronic
1121529417 14:94641763-94641785 GGCCTCCTCTAGGCTCTGGTTGG - Intergenic
1122267872 14:100555084-100555106 GGCCAACTGTAGGTTCTGCTGGG - Intronic
1122823032 14:104356564-104356586 GCCCACCTTTTGGCCCTGCTGGG - Intergenic
1202854374 14_GL000225v1_random:41602-41624 GGCCCCCTATAGGCAGAGCTTGG + Intergenic
1124034152 15:26038795-26038817 GGCCTCCCTCAGGCTTTGCTGGG + Intergenic
1126384982 15:48084981-48085003 GGCCCCCTGTAGTCTCTTTTGGG - Intergenic
1126969163 15:54090213-54090235 GGGTCCTTTTAGACTCTGCTGGG + Intronic
1130788143 15:87123105-87123127 GGGCCCCTTTGGGCCTTGCTTGG + Intergenic
1131558587 15:93420089-93420111 GTCCTCCCTGAGGCTCTGCTGGG + Intergenic
1132883297 16:2171701-2171723 GGCCCTGTTTGGCCTCTGCTGGG + Intronic
1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG + Intronic
1138522336 16:57578015-57578037 GGCCCCATCTGGGCTCTGCTGGG - Intronic
1139033285 16:62911618-62911640 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
1140114574 16:72030375-72030397 TGCCCACTTTACACTCTGCTTGG - Intergenic
1141601438 16:85128940-85128962 TGCAGCCTTTAGGCTCTGCCTGG - Intergenic
1141847124 16:86618471-86618493 GGTCCCCTAAAGGCTCAGCTGGG - Intergenic
1144438872 17:15263441-15263463 AGCCCCCTTCAGTCTCGGCTTGG + Intronic
1147149665 17:38507325-38507347 GGTCCCCTGTAAGCTCTGCATGG + Intronic
1147307957 17:39576619-39576641 AGCCCCTTGTAGGCTCTCCTGGG + Intergenic
1147898256 17:43766682-43766704 GGTCCCCTTTTGGCTCTGAGGGG - Exonic
1148683455 17:49487480-49487502 GGCACCCTGTAGGCTGGGCTGGG + Intergenic
1149101208 17:52909171-52909193 GGCCCCTTTTAGTCACAGCTGGG - Intergenic
1154299753 18:13182765-13182787 GTCCCCCTCTAGGCTCAGATGGG - Intergenic
1155561168 18:27078760-27078782 GGCCTTCTTTAGCCTCAGCTAGG + Intronic
1158442291 18:57487441-57487463 GGCCCTCTTTGATCTCTGCTTGG + Exonic
1160535203 18:79587954-79587976 GGCTCACTTTCCGCTCTGCTCGG + Intergenic
1161294690 19:3513696-3513718 GGCACCCATGAGGCTCTGGTCGG + Intronic
1162002726 19:7757640-7757662 GGCCCCTTTTAGCCACAGCTGGG - Intergenic
1163191494 19:15680124-15680146 GGCCCCCTTCCTGCTATGCTGGG + Intronic
1163201721 19:15774435-15774457 GGCCCCCTTCCTGCTATGCTGGG - Intergenic
1164412022 19:28014167-28014189 GTCTTCCTTTAGACTCTGCTAGG + Intergenic
1164888628 19:31804481-31804503 GGCCACCAATAGGCTCTGCCTGG - Intergenic
1166763490 19:45238832-45238854 GGCCCCCTTCCGGCTGGGCTGGG - Intronic
1168352440 19:55684376-55684398 GGCCCCCTTAAGGCTCTGCAGGG - Intronic
1168692344 19:58384833-58384855 GGCACCCTCTGGGCCCTGCTGGG - Intergenic
925318082 2:2940343-2940365 GGCCACCTGTATGCTCTGGTTGG + Intergenic
925436597 2:3843418-3843440 GGCCCCTCTCAGGCTCTGCAAGG + Intronic
927917233 2:26945041-26945063 GGCCCACCTGGGGCTCTGCTCGG + Intronic
937646290 2:124269352-124269374 GGCCCCCATTAAGCTGAGCTAGG + Intronic
941165513 2:162079064-162079086 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
941385391 2:164844616-164844638 GGCCCCCAGTAGGTTCTGTTAGG + Intergenic
941582697 2:167318914-167318936 GGGCCCCTGCAGGCTCTGATAGG - Intergenic
942234300 2:173889469-173889491 GGCCCCTTTTAGCCACAGCTAGG - Intergenic
943006569 2:182393297-182393319 GGCCCCTTTTAGCCACAGCTGGG + Intronic
943620245 2:190140598-190140620 GGCCCCTTTTAGCCACAGCTGGG + Intronic
943998050 2:194797001-194797023 GGCCCCTTTTAGCCACGGCTGGG - Intergenic
947544425 2:231001046-231001068 AGCCCCCTTCAGACTGTGCTGGG + Intronic
947590708 2:231383458-231383480 TGCCACCTTTAGGCTCTTGTGGG + Intergenic
947704081 2:232260365-232260387 AGCCCCTTTTAGGCTCAGCCAGG - Intronic
948837681 2:240633963-240633985 GGCCCCTTTTAGCCACTGCTGGG - Intergenic
1170907278 20:20527767-20527789 GGCCCCCTTAAGGATGTGCGTGG + Intronic
1172015627 20:31870799-31870821 GTCCCCCTTCCGGCTCTGCCTGG + Intronic
1172623951 20:36336880-36336902 GGGCCCCTCTGGGGTCTGCTGGG - Intronic
1173614790 20:44395564-44395586 GGCCACCAAGAGGCTCTGCTAGG - Intronic
1178116607 21:29424190-29424212 AGCCCCCATTAGTCTCTCCTAGG - Intronic
1178431531 21:32522353-32522375 GGAGCCCTTTAGGCTCTCCAAGG - Intergenic
1181109197 22:20591458-20591480 GGCCCTCTTTCTGCTCTGGTGGG + Intergenic
1181927825 22:26374771-26374793 ATCCCCCTTTAAGCTATGCTGGG + Intronic
1184240747 22:43210261-43210283 GGGCCTCATCAGGCTCTGCTGGG + Intronic
949156265 3:830519-830541 GGCCCCTTTTAGCCACGGCTGGG + Intergenic
951936080 3:28024606-28024628 GGCCCCTTTTAGTCACAGCTAGG - Intergenic
952022452 3:29040156-29040178 GGCCCCTTTTAGCCACAGCTGGG - Intergenic
952191283 3:31025907-31025929 GGTCTCCTCTAGGCTCTGGTAGG - Intergenic
952529681 3:34250476-34250498 GGCCCCCAATAGTCTCTACTGGG - Intergenic
954412461 3:50376748-50376770 GCCCCCCTGAAGCCTCTGCTTGG - Intronic
956840273 3:73133905-73133927 GGCTCCTTTGAGCCTCTGCTGGG + Intergenic
956952161 3:74295222-74295244 GGGCCACTGTAGGCTCTGTTCGG + Exonic
957956559 3:87195933-87195955 GGCCCCTTTTAGCCAATGCTGGG - Intergenic
960581436 3:119282582-119282604 GGCCCCTTTTAGCCACAGCTGGG - Intergenic
960669630 3:120143900-120143922 GGCCCCCTTCAGTTTCTGGTAGG + Intergenic
963539502 3:146567206-146567228 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
964897192 3:161612725-161612747 GGCCCCTTTTAGCCACAGCTGGG - Intergenic
965361239 3:167741172-167741194 GGCCCCCTTCTGGTTCTGCCTGG + Intronic
967946020 3:194804929-194804951 GGCAACCTTTAGGCACTGCAGGG - Intergenic
968908136 4:3463820-3463842 GGGCCCCTTGCTGCTCTGCTGGG - Intronic
972880588 4:43417560-43417582 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
973725745 4:53773928-53773950 TGCCCCCTTTAGCTTCTGCCAGG - Intronic
974872478 4:67660422-67660444 GGCCCCTTTTAGCCACAGCTGGG - Intronic
974966081 4:68761903-68761925 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
977015999 4:91693801-91693823 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
978666038 4:111183091-111183113 AGCCCCCTTTAGCCTTGGCTGGG + Intergenic
983048176 4:163011459-163011481 GGCCCCTTTTAGCCACAGCTTGG + Intergenic
985956644 5:3270686-3270708 GGCCCCACTTCTGCTCTGCTGGG + Intergenic
987254670 5:16138271-16138293 GGCCCCTTTTAGCCACAGCTGGG - Intronic
988362657 5:30255660-30255682 GGCCCCCTTTAGCCATGGCTGGG + Intergenic
989224539 5:39011164-39011186 GGCCCCTTTTAGCCACGGCTGGG - Intronic
995120681 5:108532635-108532657 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
995627254 5:114092790-114092812 GGCCCCCTTTAGCCATGGCTGGG + Intergenic
995698449 5:114905864-114905886 GGCCCCTTTTAGCCACAGCTAGG + Intergenic
999054744 5:148562353-148562375 GGCTCCTTTTAGGCTCTTATAGG - Intronic
999451253 5:151679779-151679801 GGCCTCCTTTGGGCTCTCCTTGG + Intronic
1000183432 5:158835516-158835538 TGGCACCTTTAGGCTCTGCTAGG + Intronic
1001530548 5:172458410-172458432 AGATCCATTTAGGCTCTGCTTGG + Intergenic
1002563463 5:180097641-180097663 GGCCCTCTGCAGGCCCTGCTGGG - Intergenic
1007332778 6:41126739-41126761 AGCCTCCTTAAGGTTCTGCTGGG - Intergenic
1011378658 6:86719019-86719041 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
1014133995 6:117866677-117866699 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
1018427378 6:163695529-163695551 GGCCTCATTCAGGCTCTGCGGGG + Intergenic
1018922722 6:168186596-168186618 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
1019662497 7:2232634-2232656 CTCCCCCTTTGGGCTGTGCTGGG - Intronic
1019892673 7:3959236-3959258 GGCTTCCTTTTTGCTCTGCTGGG - Intronic
1020869288 7:13607551-13607573 GGCCCCTTTTAGCCGCAGCTGGG - Intergenic
1021783567 7:24130317-24130339 GGCCCCCTTTAGGAACAGCCAGG + Intergenic
1022417061 7:30187629-30187651 GGCCCCTTTTAGCCACGGCTGGG + Intergenic
1024667251 7:51559284-51559306 GGCCCCTTTTAGCCACTGCTGGG - Intergenic
1027990981 7:85360747-85360769 GGCCCCTTTTAGCCACAGCTGGG - Intergenic
1028099059 7:86797894-86797916 GGCCCCTTTTAGCCACGGCTGGG - Intronic
1028404853 7:90464264-90464286 GGCCCCTTTTAGCCACAGCTGGG - Intronic
1031172512 7:118309270-118309292 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
1032979313 7:137263830-137263852 GGCCCCCACTAGGCTATACTGGG - Intronic
1033781838 7:144680241-144680263 GGTCCTCTTCAGGCTCTCCTAGG + Intronic
1034715398 7:153236920-153236942 GACCCTCTTTGGGCTCTGCTGGG - Intergenic
1039105108 8:33981808-33981830 GGGCCCCTCTCTGCTCTGCTGGG + Intergenic
1041434206 8:57819764-57819786 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
1041849842 8:62378580-62378602 GGCCCCTTTTAGACTATACTGGG - Intronic
1046452826 8:114415804-114415826 GGCCCCCTTTAGCCACAGCTGGG + Intergenic
1048053905 8:130846111-130846133 GGCTCCCTGTAGTCTCTTCTAGG - Intronic
1048909723 8:139123553-139123575 GGCTGCCTTTGGGGTCTGCTTGG - Intergenic
1050890565 9:10819355-10819377 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
1051365762 9:16320331-16320353 GGCCATCTTCAGGATCTGCTGGG - Intergenic
1051743916 9:20276867-20276889 GGCCCCTTTTAGCCACTGCTGGG + Intergenic
1051967393 9:22845340-22845362 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
1053218495 9:36292520-36292542 TGCCACCTTTAGGCTGAGCTGGG + Intronic
1053282539 9:36830346-36830368 GGCCCCCATCACGATCTGCTGGG + Intergenic
1053672646 9:40384018-40384040 GGCTCACTGTAAGCTCTGCTAGG + Intergenic
1053922459 9:43010406-43010428 GGCTCACTGTAAGCTCTGCTAGG + Intergenic
1054383758 9:64524080-64524102 GGCTCACTGTAAGCTCTGCTAGG + Intergenic
1054511979 9:65992265-65992287 GGCTCACTGTAAGCTCTGCTAGG - Intergenic
1055701532 9:78949941-78949963 TGGCCCCTTTAGGCACAGCTGGG - Intergenic
1057401673 9:94728747-94728769 GGCCACCTTCAGGCTATGCGGGG + Intronic
1057892091 9:98877078-98877100 GGCTCCCTTGAGGCTCTCCAAGG - Intergenic
1059492236 9:114677819-114677841 GGCCTCTTTTAGGCTCTGCTTGG + Intergenic
1060826084 9:126688851-126688873 GGCCCCCTTGAGGATCAGATGGG + Intronic
1061362052 9:130149827-130149849 GGCCCCCTTCAGGCCCATCTGGG + Intergenic
1062395755 9:136351966-136351988 GGCCCCCTTCCCCCTCTGCTGGG + Intronic
1203789799 EBV:144648-144670 GGCGCCCATTAGAATCTGCTCGG - Intergenic
1187073863 X:15914860-15914882 GGACCCCTCCAGGCTCTGATGGG + Intergenic
1188115618 X:26238990-26239012 GGCCCCCTTTAGCTACAGCTGGG + Intergenic
1189176576 X:38963584-38963606 GGCCCCTTTTAGCCACAGCTGGG + Intergenic
1189299404 X:39941829-39941851 GGCCCCCTGTAGGCTTTGGGTGG - Intergenic
1190373601 X:49766600-49766622 GGCCCCCTTCAGGTTCTGCCAGG - Intergenic
1192689676 X:73349241-73349263 GGCCCCTTTTAGCCACAGCTGGG - Intergenic
1194525243 X:94969555-94969577 GGCCCCCTTTAGCCACGGCTGGG - Intergenic
1199400696 X:147395348-147395370 GGCCCCTTTTAGCCACGGCTGGG - Intergenic
1201125759 Y:10912673-10912695 GGCCCCCTATAGGCAGAGCTTGG + Intergenic