ID: 1119753000

View in Genome Browser
Species Human (GRCh38)
Location 14:77093779-77093801
Sequence AGGCAGAGGCCAGTGATAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119753000_1119753007 16 Left 1119753000 14:77093779-77093801 CCCACTATCACTGGCCTCTGCCT No data
Right 1119753007 14:77093818-77093840 GTAGATCCCCCTGCCCACACAGG No data
1119753000_1119753008 20 Left 1119753000 14:77093779-77093801 CCCACTATCACTGGCCTCTGCCT No data
Right 1119753008 14:77093822-77093844 ATCCCCCTGCCCACACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119753000 Original CRISPR AGGCAGAGGCCAGTGATAGT GGG (reversed) Intergenic
No off target data available for this crispr