ID: 1119753007

View in Genome Browser
Species Human (GRCh38)
Location 14:77093818-77093840
Sequence GTAGATCCCCCTGCCCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119753005_1119753007 -10 Left 1119753005 14:77093805-77093827 CCATCTGGCACCTGTAGATCCCC No data
Right 1119753007 14:77093818-77093840 GTAGATCCCCCTGCCCACACAGG No data
1119753000_1119753007 16 Left 1119753000 14:77093779-77093801 CCCACTATCACTGGCCTCTGCCT No data
Right 1119753007 14:77093818-77093840 GTAGATCCCCCTGCCCACACAGG No data
1119753003_1119753007 2 Left 1119753003 14:77093793-77093815 CCTCTGCCTCTGCCATCTGGCAC No data
Right 1119753007 14:77093818-77093840 GTAGATCCCCCTGCCCACACAGG No data
1119753004_1119753007 -4 Left 1119753004 14:77093799-77093821 CCTCTGCCATCTGGCACCTGTAG No data
Right 1119753007 14:77093818-77093840 GTAGATCCCCCTGCCCACACAGG No data
1119753001_1119753007 15 Left 1119753001 14:77093780-77093802 CCACTATCACTGGCCTCTGCCTC No data
Right 1119753007 14:77093818-77093840 GTAGATCCCCCTGCCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119753007 Original CRISPR GTAGATCCCCCTGCCCACAC AGG Intergenic
No off target data available for this crispr