ID: 1119753121

View in Genome Browser
Species Human (GRCh38)
Location 14:77094832-77094854
Sequence GCCCTTAAATCCTACATTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119753121_1119753124 2 Left 1119753121 14:77094832-77094854 CCCTAAATGTAGGATTTAAGGGC No data
Right 1119753124 14:77094857-77094879 ATGTCTCCCCCTGCTGGTTGTGG No data
1119753121_1119753125 5 Left 1119753121 14:77094832-77094854 CCCTAAATGTAGGATTTAAGGGC No data
Right 1119753125 14:77094860-77094882 TCTCCCCCTGCTGGTTGTGGTGG No data
1119753121_1119753123 -4 Left 1119753121 14:77094832-77094854 CCCTAAATGTAGGATTTAAGGGC No data
Right 1119753123 14:77094851-77094873 GGGCGCATGTCTCCCCCTGCTGG No data
1119753121_1119753128 9 Left 1119753121 14:77094832-77094854 CCCTAAATGTAGGATTTAAGGGC No data
Right 1119753128 14:77094864-77094886 CCCCTGCTGGTTGTGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119753121 Original CRISPR GCCCTTAAATCCTACATTTA GGG (reversed) Intergenic
No off target data available for this crispr