ID: 1119753123

View in Genome Browser
Species Human (GRCh38)
Location 14:77094851-77094873
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119753121_1119753123 -4 Left 1119753121 14:77094832-77094854 CCCTAAATGTAGGATTTAAGGGC No data
Right 1119753123 14:77094851-77094873 GGGCGCATGTCTCCCCCTGCTGG No data
1119753122_1119753123 -5 Left 1119753122 14:77094833-77094855 CCTAAATGTAGGATTTAAGGGCG No data
Right 1119753123 14:77094851-77094873 GGGCGCATGTCTCCCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119753123 Original CRISPR GGGCGCATGTCTCCCCCTGC TGG Intergenic
No off target data available for this crispr