ID: 1119753517

View in Genome Browser
Species Human (GRCh38)
Location 14:77098081-77098103
Sequence CCGGAAGACCAGGCCGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119753517_1119753532 7 Left 1119753517 14:77098081-77098103 CCCGCGCCGGCCTGGTCTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1119753532 14:77098111-77098133 GGGGAAAGGGCGCATTTCCAAGG 0: 1
1: 0
2: 2
3: 14
4: 149
1119753517_1119753534 18 Left 1119753517 14:77098081-77098103 CCCGCGCCGGCCTGGTCTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1119753534 14:77098122-77098144 GCATTTCCAAGGGCCCTTCTAGG 0: 1
1: 0
2: 1
3: 16
4: 151
1119753517_1119753529 -7 Left 1119753517 14:77098081-77098103 CCCGCGCCGGCCTGGTCTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1119753529 14:77098097-77098119 CTTCCGGCGGGGGCGGGGAAAGG 0: 1
1: 0
2: 2
3: 24
4: 262
1119753517_1119753530 -6 Left 1119753517 14:77098081-77098103 CCCGCGCCGGCCTGGTCTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1119753530 14:77098098-77098120 TTCCGGCGGGGGCGGGGAAAGGG 0: 1
1: 0
2: 0
3: 17
4: 171
1119753517_1119753533 8 Left 1119753517 14:77098081-77098103 CCCGCGCCGGCCTGGTCTTCCGG 0: 1
1: 0
2: 0
3: 7
4: 130
Right 1119753533 14:77098112-77098134 GGGAAAGGGCGCATTTCCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119753517 Original CRISPR CCGGAAGACCAGGCCGGCGC GGG (reversed) Exonic
901002776 1:6156848-6156870 CCAGATGACCAGGCCCGGGCTGG + Intronic
901218028 1:7565537-7565559 CCGGAACAGCAGGACGGGGCTGG + Intronic
901641550 1:10695326-10695348 CCGGAAGACCGGGGAGGCTCTGG - Intronic
903745208 1:25582023-25582045 TGGGAAGCCCAGGCCTGCGCTGG - Intergenic
904468017 1:30719325-30719347 CCGGGAGGCCCGGCCGGGGCTGG + Intronic
904623121 1:31787455-31787477 CCCGAAGACCAGGGCAGAGCAGG - Intergenic
905789952 1:40784441-40784463 CCGGGAGGCCAGGCTTGCGCGGG - Intronic
909957776 1:81801002-81801024 CCCGAGGACCAGGCCGGCCCCGG - Intronic
915343462 1:155188606-155188628 CCCGGACACCAGGCCGGCCCCGG - Intronic
915343522 1:155188744-155188766 CCCGGACACCAGGCCGGCCCCGG - Intronic
915343548 1:155188804-155188826 CCCGGACACCAGGCCGGCCCCGG - Intronic
915343572 1:155188864-155188886 CCCGGACACCAGGCCGGCACCGG - Intronic
915343597 1:155188924-155188946 CCCGGACACCAGGCCGGCCCCGG - Intronic
915343722 1:155189289-155189311 CCCGGACACCAGGCCGGCCCCGG - Intronic
915343748 1:155189349-155189371 CCCGGACACCAGGCCGGCCCCGG - Intronic
915343774 1:155189409-155189431 CCCGGACACCAGGCCGGCCCCGG - Intronic
915343800 1:155189469-155189491 CCCGGACACCAGGCCGGCCCCGG - Intronic
915343825 1:155189529-155189551 CCCGGAGAGCAGGCCGGCCCCGG - Intronic
915343844 1:155189589-155189611 CCCGGAGAGCAGGCCGGCCCCGG - Intronic
915343870 1:155189649-155189671 CCCGGACACCAGGCCGGCCCCGG - Intronic
915343896 1:155189709-155189731 CCCGGACACCAGGCCGGCCCCGG - Intronic
915343922 1:155189769-155189791 CCCGGACACCAGGCCGGCCCCGG - Intronic
915343947 1:155189829-155189851 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344018 1:155190009-155190031 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344043 1:155190069-155190091 CCCGGAGAGCAGGCCGGCCCCGG - Intronic
915344064 1:155190129-155190151 CCCGGAGAGCAGGCCGGCCCCGG - Intronic
915344086 1:155190189-155190211 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344175 1:155190426-155190448 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344227 1:155190547-155190569 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344252 1:155190607-155190629 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344326 1:155190787-155190809 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344366 1:155190882-155190904 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344417 1:155190996-155191018 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344442 1:155191056-155191078 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344516 1:155191236-155191258 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344541 1:155191296-155191318 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344598 1:155191477-155191499 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344648 1:155191597-155191619 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344744 1:155191837-155191859 CCCGGACACCAGGCCGGCCCCGG - Intronic
915344769 1:155191897-155191919 CCCGGACACCAGGCCGGCCCCGG - Intronic
920504746 1:206507845-206507867 GCTGCAGACCAGGCCGGAGCGGG - Exonic
923055817 1:230425651-230425673 GAGGAGGACGAGGCCGGCGCGGG - Intronic
1067439212 10:46299116-46299138 CAGGAAGGCCAGGCAGGTGCAGG + Intronic
1067581458 10:47449204-47449226 CAGGAAGGCCAGGCAGGTGCAGG + Intergenic
1071988721 10:91077934-91077956 CTGAAAGACCAGGAAGGCGCTGG - Intergenic
1073421086 10:103424192-103424214 CCAGAAGACAAGGCAGGCGAGGG - Intronic
1074503234 10:114044434-114044456 CCCCATGACCAGGTCGGCGCTGG - Exonic
1075522058 10:123148841-123148863 CAGGAAGCCCAAGCCGGCACGGG - Intronic
1076834676 10:133015023-133015045 CCTGCAGGCCAGGCCGGCTCCGG + Intergenic
1077524769 11:3057447-3057469 CCGGAAGACGGGCCCGGCGTGGG - Intronic
1079035285 11:17014686-17014708 CCGGGAGACCCGGGCGGCGCGGG + Intergenic
1080668793 11:34357903-34357925 CCGGGAGAACAGGGCGGCGGCGG + Exonic
1083660111 11:64247977-64247999 CCAGCAGACCAGGTCGGCGCAGG - Intergenic
1083728289 11:64639875-64639897 CTGGAGGACCAGGCCAGCTCAGG - Intronic
1083920070 11:65777830-65777852 CCGGGAGACCAGGTGGGGGCAGG - Exonic
1084086305 11:66856905-66856927 CCCGAGGCCCGGGCCGGCGCGGG - Intronic
1088849635 11:113694543-113694565 CCGGAAGCCCAGGGCCACGCTGG + Exonic
1089497146 11:118913607-118913629 CAGGAAGCCCAGGCAGGCGGCGG + Intronic
1089906629 11:122046617-122046639 CTGGCAAACCAGGCCGGGGCTGG + Intergenic
1091611832 12:2016976-2016998 CTGGAAAAACAGGCTGGCGCTGG + Intronic
1096608779 12:52787538-52787560 CAGGAAGGCCAGGCCTGCTCTGG + Intergenic
1100679829 12:96907247-96907269 CCGGAAGCCCAGCGCGGAGCCGG + Intronic
1105705815 13:22966806-22966828 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1105858718 13:24391792-24391814 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1114527749 14:23377086-23377108 CCGGGAGAGAAGGCAGGCGCTGG - Exonic
1119753517 14:77098081-77098103 CCGGAAGACCAGGCCGGCGCGGG - Exonic
1132592075 16:730423-730445 CCGGATGCCCAGGCCAGTGCTGG + Exonic
1132870403 16:2113248-2113270 CCGGAAGACCATGTCCGAGCCGG + Exonic
1132915226 16:2340441-2340463 CCCGCAGGCCAGGCCGGAGCTGG + Intronic
1133121566 16:3611720-3611742 CCGGAAGCGCTGGCCGCCGCGGG - Intronic
1134709806 16:16322328-16322350 CCGGAAGACCATGTCCGAGCCGG - Intergenic
1134717020 16:16362358-16362380 CCGGAAGACCATGTCCGAGCCGG - Intergenic
1134949797 16:18346317-18346339 CCGGAAGACCATGTCCGAGCCGG + Intergenic
1134957731 16:18389801-18389823 CCGGAAGACCATGTCCGAGCCGG + Intergenic
1137559239 16:49492462-49492484 CCGGAGGCCGAGGCCGGGGCCGG + Intronic
1141075884 16:81006595-81006617 CAGGAAGACCCGGCTGCCGCAGG - Intronic
1141839493 16:86565773-86565795 CCCGTGGCCCAGGCCGGCGCCGG - Intergenic
1143450888 17:7036168-7036190 ACTGAAGACCTGGCCCGCGCTGG - Exonic
1143681061 17:8476414-8476436 CCAGAAGACCAGGTCGGCGGAGG - Intronic
1147769611 17:42858429-42858451 CCAGAAGCCCAGGCCAGGGCAGG + Intergenic
1152608098 17:81303062-81303084 CCAGAGCACCAGGCCGGGGCAGG - Intergenic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1160805937 19:992161-992183 CCGGAAGACCCCGCGGGCCCTGG + Intronic
1161554483 19:4932909-4932931 GCGCGAGACCAGGACGGCGCGGG + Exonic
1162028698 19:7908310-7908332 CTGGAGGACCAGGCAGGAGCAGG - Intronic
1165448223 19:35868479-35868501 CAGGAAGGCGGGGCCGGCGCGGG + Exonic
1165549733 19:36573661-36573683 CCGGAAGCCCGGGCCGGGGAGGG + Intronic
1166976174 19:46606309-46606331 CCAGCAGAACAGGCAGGCGCAGG - Intronic
1167578349 19:50328391-50328413 CTGGACGACGAGGCGGGCGCGGG - Exonic
1167935018 19:52898409-52898431 CCGGAGGTCCAGGCCAGCGTGGG + Intergenic
1168023475 19:53626637-53626659 CCGGAAGACCAGTCCTGGGAAGG - Intergenic
925988020 2:9231589-9231611 GAGGAAGAACAGGCAGGCGCAGG - Intronic
934145161 2:89085859-89085881 CCTGACAACCAGGGCGGCGCAGG - Intergenic
934224091 2:90114696-90114718 CCTGACAACCAGGGCGGCGCAGG + Intergenic
934230153 2:90172708-90172730 CCTGACAACCAGGGCGGCGCAGG + Intergenic
936664674 2:114580618-114580640 CAGAAAGACCAGGCAGGAGCTGG - Intronic
942459047 2:176157144-176157166 CCGGCCGCCCAGCCCGGCGCGGG - Intronic
945080774 2:206085259-206085281 CCGGACGGCCAGGCCGGGGCGGG - Intronic
1172033596 20:31997349-31997371 CCGGAAGACCATCCTGGCACTGG + Exonic
1175931467 20:62495806-62495828 CCGGGAGCCCGGGCCGGGGCTGG - Intergenic
1176221068 20:63969649-63969671 CAGGAAGACGGCGCCGGCGCGGG + Intronic
1177010877 21:15729790-15729812 CGGGAACGCCAGGCCCGCGCAGG + Intergenic
1178797096 21:35755201-35755223 CCGGGAGACCAACCCGGTGCAGG + Intronic
1179615486 21:42580598-42580620 ACCGAAGACCCGGCCGGCCCTGG + Exonic
1181168091 22:20993983-20994005 CAGGAAGATCACGCAGGCGCGGG + Exonic
1181681036 22:24495804-24495826 CCAGAAGACAAGCCCGGCTCCGG - Intronic
1182097884 22:27638263-27638285 CAGGAAGGCCAGGGCGGGGCTGG - Intergenic
1183411760 22:37659073-37659095 CCGGAGGCCCGGGCAGGCGCTGG - Exonic
1184769086 22:46587579-46587601 CAGGCAGCCCAGGCCGGGGCGGG + Intronic
956729212 3:72181409-72181431 CAGGAAGACCTGGCAGGGGCCGG - Intergenic
965757439 3:172040379-172040401 CGGGGGGGCCAGGCCGGCGCGGG - Intronic
968319267 3:197750593-197750615 CCGGCAGCCATGGCCGGCGCCGG - Intronic
969436576 4:7192566-7192588 CCGGGAGAGCAGGAGGGCGCTGG - Exonic
969705994 4:8791898-8791920 CCGGAACACCAAGCGGGCCCAGG - Intergenic
975661911 4:76696833-76696855 TTGGAAGACCAGGCAGGCTCTGG + Intronic
985985279 5:3510633-3510655 CCGGGAGACCAGGCAGGAGGAGG + Intergenic
989812638 5:45696096-45696118 CCGGAGGACGCGGCCGGCGACGG + Exonic
1003074406 6:2971149-2971171 ACGGAAGAGGCGGCCGGCGCGGG - Intronic
1006335322 6:33417559-33417581 CCGGAATCCGAGGCCGGCGAGGG + Exonic
1019314722 7:379182-379204 CTGGAGGACGAGGCCGGCCCGGG + Intergenic
1019709466 7:2511682-2511704 CCTGAAGACAAGGCTGGGGCTGG - Intergenic
1025007559 7:55366110-55366132 CCGGACTACGAGGCCGCCGCCGG + Exonic
1029484270 7:100829566-100829588 CAGGCAGACCAGGCTGGAGCTGG + Intronic
1032084131 7:128874694-128874716 CCGCAAGCCCAGGCCAGCTCAGG - Intronic
1036283730 8:7424397-7424419 CTGCAAGACCAGGCCAGCCCAGG - Intergenic
1036337741 8:7887132-7887154 CTGCAAGACCAGGCCAGCCCAGG + Intergenic
1042906519 8:73777559-73777581 CCGGAAGTCCAGGGAGGCCCAGG - Intronic
1049536763 8:143186127-143186149 CCCGACGCCCAGGCCGGAGCCGG - Intergenic
1049545095 8:143226860-143226882 CCTGAAGGGCAGGCCGGTGCAGG + Intergenic
1049681515 8:143920627-143920649 TTGGAAGCCCAGGCCGGCACCGG - Exonic
1049780951 8:144428645-144428667 CCCGAAGTCCGGGCGGGCGCGGG - Intergenic
1056507402 9:87270286-87270308 ACAGAAGCCCAGGCCGGCGCTGG + Intergenic
1059696774 9:116737150-116737172 CCGAGAGACCATGCCGTCGCTGG - Intronic
1062325614 9:136011136-136011158 CCGGAAGACGAAGCAGGGGCCGG - Exonic
1062590595 9:137272844-137272866 CCGGAAGCCCAGCCCGGCACAGG + Exonic
1203364778 Un_KI270442v1:247903-247925 CCCGAAGACGAGGACGGCGAAGG + Intergenic
1192630805 X:72776903-72776925 CGGGAAGACCCGGGCGGCGGAGG + Intergenic
1192650905 X:72943901-72943923 CGGGAAGACCCGGGCGGCGGAGG - Intergenic