ID: 1119753916

View in Genome Browser
Species Human (GRCh38)
Location 14:77100394-77100416
Sequence CACAAAAATTAGCTGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4755
Summary {0: 4, 1: 58, 2: 675, 3: 1374, 4: 2644}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119753916_1119753920 -6 Left 1119753916 14:77100394-77100416 CCCAAGCCCAGCTAATTTTTGTG 0: 4
1: 58
2: 675
3: 1374
4: 2644
Right 1119753920 14:77100411-77100433 TTTGTGTTTTTAGTAGAGACAGG 0: 6301
1: 173952
2: 213474
3: 129693
4: 84145
1119753916_1119753921 -5 Left 1119753916 14:77100394-77100416 CCCAAGCCCAGCTAATTTTTGTG 0: 4
1: 58
2: 675
3: 1374
4: 2644
Right 1119753921 14:77100412-77100434 TTGTGTTTTTAGTAGAGACAGGG 0: 2644
1: 69443
2: 166474
3: 191219
4: 126697
1119753916_1119753924 18 Left 1119753916 14:77100394-77100416 CCCAAGCCCAGCTAATTTTTGTG 0: 4
1: 58
2: 675
3: 1374
4: 2644
Right 1119753924 14:77100435-77100457 TTTCACCATATTGGCCAGGCTGG 0: 10089
1: 109748
2: 162818
3: 167876
4: 157265
1119753916_1119753922 9 Left 1119753916 14:77100394-77100416 CCCAAGCCCAGCTAATTTTTGTG 0: 4
1: 58
2: 675
3: 1374
4: 2644
Right 1119753922 14:77100426-77100448 GAGACAGGGTTTCACCATATTGG 0: 3546
1: 42238
2: 95821
3: 134425
4: 106730
1119753916_1119753923 14 Left 1119753916 14:77100394-77100416 CCCAAGCCCAGCTAATTTTTGTG 0: 4
1: 58
2: 675
3: 1374
4: 2644
Right 1119753923 14:77100431-77100453 AGGGTTTCACCATATTGGCCAGG 0: 3014
1: 43547
2: 137189
3: 181874
4: 185934

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119753916 Original CRISPR CACAAAAATTAGCTGGGCTT GGG (reversed) Intronic
Too many off-targets to display for this crispr