ID: 1119754547

View in Genome Browser
Species Human (GRCh38)
Location 14:77105965-77105987
Sequence CAGAATTACCATTTTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 269}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119754547_1119754551 15 Left 1119754547 14:77105965-77105987 CCTGCTTTAAAATGGTAATTCTG 0: 1
1: 0
2: 0
3: 25
4: 269
Right 1119754551 14:77106003-77106025 GTACCCATCAAAGTCACCACAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1119754547_1119754548 -8 Left 1119754547 14:77105965-77105987 CCTGCTTTAAAATGGTAATTCTG 0: 1
1: 0
2: 0
3: 25
4: 269
Right 1119754548 14:77105980-77106002 TAATTCTGATGCCATATGTCAGG 0: 1
1: 0
2: 4
3: 20
4: 216
1119754547_1119754552 16 Left 1119754547 14:77105965-77105987 CCTGCTTTAAAATGGTAATTCTG 0: 1
1: 0
2: 0
3: 25
4: 269
Right 1119754552 14:77106004-77106026 TACCCATCAAAGTCACCACAGGG 0: 1
1: 0
2: 0
3: 7
4: 112
1119754547_1119754549 -7 Left 1119754547 14:77105965-77105987 CCTGCTTTAAAATGGTAATTCTG 0: 1
1: 0
2: 0
3: 25
4: 269
Right 1119754549 14:77105981-77106003 AATTCTGATGCCATATGTCAGGG 0: 1
1: 0
2: 2
3: 18
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119754547 Original CRISPR CAGAATTACCATTTTAAAGC AGG (reversed) Intronic
904134941 1:28304827-28304849 CAGAATTACCAGTGTAAAGGAGG - Intergenic
905173373 1:36122226-36122248 CAGCATTCCCATTTTAGAGATGG + Intronic
906457396 1:46008910-46008932 CTGAATTTTCATTTTCAAGCAGG + Intronic
908806794 1:67940085-67940107 CAGAGTTTCTAGTTTAAAGCTGG + Intergenic
908861601 1:68496432-68496454 CAGAAATACCGTTTTGAAACAGG + Intronic
909390901 1:75120666-75120688 CAGAACTAAGATTTCAAAGCTGG + Intergenic
910277149 1:85461998-85462020 CATAATTCCTATTTTAAAGTTGG - Intronic
910997679 1:93126055-93126077 GAGAATTTCAATTTTAAAGGAGG - Intronic
911287091 1:96009075-96009097 CAGAAAAACCATTTTAAAGATGG - Intergenic
912951198 1:114121738-114121760 CAGTATTTCCATTTTATAGATGG - Intronic
913636857 1:120770769-120770791 CAGAATTACCTGTTTTAAGTTGG + Intergenic
914281856 1:146182243-146182265 CAGAATTACCTGTTTTAAGTTGG - Intronic
914623736 1:149438062-149438084 CAGAATTACCTGTTTTAAGTTGG + Intergenic
916614715 1:166428322-166428344 TAGAATAACCAGTTTAAAGAAGG - Intergenic
916927094 1:169533851-169533873 CAGAACTACTATTTTAAGGGAGG + Intronic
916980774 1:170134663-170134685 CAGAATTATCATTTTATAATCGG + Intergenic
919506170 1:198400073-198400095 GAGGGTTACAATTTTAAAGCAGG + Intergenic
921170726 1:212546151-212546173 CAGAATTTCCATTTTTCAGATGG - Intergenic
921240437 1:213175491-213175513 CAGCATCACCATTTTAATACAGG + Intronic
921338916 1:214114861-214114883 CAGAATGACCAGTTGAAAGCTGG + Intergenic
922602759 1:226870003-226870025 AAAATTTACCATTTTAAAGTGGG - Intergenic
923400417 1:233611259-233611281 CAGAATAAGCATTTAAAAGGTGG + Intergenic
924688152 1:246317376-246317398 CTGAATTAACATTTGTAAGCTGG - Intronic
924792575 1:247266411-247266433 CAGAATAAGCATTTAAAAGGCGG - Intergenic
1064009774 10:11726492-11726514 CCTAATTATCATTTTAAATCAGG - Intergenic
1065512303 10:26491685-26491707 CAGAAATATCTTTTGAAAGCAGG + Intronic
1065698603 10:28403183-28403205 CATCATTGCCCTTTTAAAGCAGG - Intergenic
1065741130 10:28798102-28798124 CAGAATTTCCTTTTTGAGGCTGG + Intergenic
1066618091 10:37316195-37316217 CAGAATAAGCATTTAAAAGGTGG + Intronic
1067528815 10:47055655-47055677 CAGACTCACCATGTTGAAGCAGG - Intergenic
1068047993 10:51912160-51912182 CAGACACACCATTTTAAAGTAGG + Intronic
1068162741 10:53287437-53287459 CAGACTTACCCTTTTTAAACAGG - Intergenic
1069431838 10:68343494-68343516 CAAAATTGCCCTTTTAAAGCAGG + Intronic
1070037304 10:72739449-72739471 TAAAGTTAACATTTTAAAGCTGG - Intronic
1070235856 10:74625381-74625403 CACAATTACCATTTCAGAGATGG - Intronic
1073132379 10:101197916-101197938 AAGGACTACCCTTTTAAAGCCGG - Intergenic
1073776611 10:106793472-106793494 CAGAATCAAGATTTTTAAGCAGG + Intronic
1076866443 10:133168608-133168630 CATCATTACCATTTTATAGCAGG + Intronic
1077242114 11:1516023-1516045 CAGCATTCCCATTTTATAGGTGG - Intergenic
1078310288 11:10234078-10234100 TAGAATTATAATTTTAAATCTGG - Intronic
1078849954 11:15154754-15154776 CAGACTTAGAATGTTAAAGCTGG - Intronic
1079085927 11:17444840-17444862 TATAATCACCATTTTAAAGATGG - Intronic
1079431102 11:20388600-20388622 AAGAATTAGCATGGTAAAGCCGG - Intronic
1082921223 11:58496464-58496486 CAGATTTCCCATTTTATAGATGG - Intergenic
1085205959 11:74731907-74731929 TAAAATGCCCATTTTAAAGCTGG - Intergenic
1086116959 11:83262547-83262569 CAGACTTACCTTCTAAAAGCTGG - Intronic
1087225568 11:95594737-95594759 CAGAATTAACATTGTTAAGCAGG - Intergenic
1088200223 11:107324141-107324163 TAGAAATACCATTTTTAAGTTGG - Intergenic
1089051382 11:115548952-115548974 CAGAATTACAATTTCTCAGCAGG - Intergenic
1089110966 11:116055740-116055762 CAGAGTTACCATGATAAAGAGGG + Intergenic
1089588680 11:119526090-119526112 CAGGATGACAATTTTAAATCAGG - Intergenic
1090587287 11:128227197-128227219 CAGAATAGCCATTTTTAAACAGG + Intergenic
1091494056 12:957159-957181 AAGAATTACCATTTTGAGGCTGG + Intronic
1093257388 12:16886852-16886874 CAGAATTAGCATTTATAAGAAGG - Intergenic
1093724906 12:22493464-22493486 GAGAAGTAGCATTTTAAAGATGG - Intronic
1094236900 12:28178271-28178293 CAGAATTCCATTTTTAAAACTGG - Intronic
1096842667 12:54389174-54389196 CAGAACTGCCATCTTAAACCTGG + Intronic
1097412256 12:59269168-59269190 CAGAATAACCAGTTTAGAGAAGG + Intergenic
1097480861 12:60124325-60124347 CCAAATTACCATTTAAAAGCAGG - Intergenic
1098803624 12:74993623-74993645 CCTAATTTCCATTTTAGAGCTGG - Intergenic
1100270279 12:93018097-93018119 CATGATTCCCATTTTAAAGATGG - Intergenic
1101803169 12:108040441-108040463 AAAAACTCCCATTTTAAAGCTGG + Intergenic
1102146817 12:110660587-110660609 AAAATTTACCATTTTAAAGTTGG + Intronic
1102306560 12:111809108-111809130 CAGAATTTCTATTTCAAATCTGG - Intronic
1102763014 12:115405580-115405602 CATAATGCCCATTTTAAAGATGG - Intergenic
1103775172 12:123362044-123362066 CAGAATAACCGTTTTAACCCAGG + Intronic
1103849447 12:123922410-123922432 CAGAATGGCCATTTTTAACCAGG + Intronic
1104230175 12:126877022-126877044 CAGAATACCCAGTCTAAAGCAGG - Intergenic
1104279273 12:127359314-127359336 AAGAATGATCTTTTTAAAGCTGG + Intergenic
1104279470 12:127361345-127361367 AAGAATGATCTTTTTAAAGCTGG - Intergenic
1105959418 13:25316502-25316524 GTGAATTACTATTTTAAAGTTGG + Intronic
1106579868 13:31008300-31008322 TAGAATTAGATTTTTAAAGCTGG + Intergenic
1106731601 13:32547021-32547043 CTGAATTACACTTTTACAGCTGG + Intergenic
1111195368 13:84869643-84869665 CAGAATAACCATTTAAAAGGTGG - Intergenic
1111196256 13:84877227-84877249 CAGAATAAGCATTTAAAAGGTGG - Intergenic
1111739393 13:92183671-92183693 CAGAATTACTATTATAAATATGG - Intronic
1112094145 13:96113940-96113962 CATAATTATCATTTTAATGGGGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1114601677 14:23960426-23960448 CAGAATTAGTATTTTAAATAAGG - Intronic
1116109379 14:40557422-40557444 CAGAATTCACATTTAAAAACAGG + Intergenic
1116688257 14:48071222-48071244 CAGAATGACCTTTTAAAAACAGG - Intergenic
1118579390 14:67278964-67278986 AAGAATTACAATATAAAAGCAGG - Intronic
1119754547 14:77105965-77105987 CAGAATTACCATTTTAAAGCAGG - Intronic
1122643953 14:103179129-103179151 CAGGATTTCCACTTCAAAGCCGG - Intergenic
1122845459 14:104494494-104494516 CAAAAATACCATTTAAAAGGGGG + Intronic
1124631726 15:31341702-31341724 CAGAACTACTGTTTTAAAGCAGG + Intronic
1125374195 15:39011525-39011547 CAGAATAAGCATTTAAAAGGTGG - Intergenic
1126119008 15:45234550-45234572 CAGAATAAGCATTTAAAAGGTGG + Intergenic
1126358563 15:47822214-47822236 CTGGATTAGCATTTTAAAACAGG - Intergenic
1126462270 15:48926757-48926779 CAGAAATACTATTATACAGCAGG - Intronic
1126760579 15:51966612-51966634 TAGAATTAACATTCTAAGGCCGG + Intronic
1127062392 15:55200423-55200445 AAAAATTAACATTTTAAAGAAGG - Intergenic
1127182891 15:56442341-56442363 CAGAATTACCATTTGATTGCTGG + Intronic
1127430419 15:58901939-58901961 CACAAATACCATTTTAAAATTGG - Intronic
1127578907 15:60318884-60318906 CAGCATTGCCATTTTAAAATCGG - Intergenic
1127625227 15:60773968-60773990 AACAATTAGCATCTTAAAGCTGG - Intronic
1129350041 15:74950732-74950754 AAGATTTACCAATTTGAAGCTGG + Intergenic
1129911340 15:79229630-79229652 CAGAATAACCCTCTTAAAGAAGG - Intergenic
1130700700 15:86177194-86177216 CGGAATTACCTTTTTATACCTGG - Intronic
1130778219 15:87007799-87007821 CAGATTTCTCATCTTAAAGCTGG + Intronic
1133555759 16:6905127-6905149 CAGCATTAGCATTTTACAGTTGG + Intronic
1133664707 16:7955229-7955251 CAGAATTTCCTTTTAAAAGCTGG + Intergenic
1134634145 16:15779442-15779464 CACTATCCCCATTTTAAAGCTGG + Intronic
1134750944 16:16624600-16624622 GCTAATTACCACTTTAAAGCAGG + Intergenic
1134994510 16:18728991-18729013 GCTAATTACCACTTTAAAGCAGG - Intergenic
1135075944 16:19393655-19393677 CAGAATAAGCATTTAAAAGGCGG + Intergenic
1135076896 16:19401639-19401661 CAGAATAAGCATTTAAAAGGCGG + Intergenic
1136045636 16:27612812-27612834 CAGAATCTGCATTTCAAAGCAGG + Intronic
1136054136 16:27675426-27675448 CAAAATTCCCATTTAAAAGAAGG + Intronic
1136645044 16:31606729-31606751 TAGAATTAAAATTTAAAAGCTGG + Intergenic
1137741880 16:50784972-50784994 AAGAATCACCTTTTTAAGGCAGG - Intronic
1137914877 16:52419020-52419042 CATAATTTCCAATTTAAAGCTGG + Intergenic
1139296333 16:65904670-65904692 CAGAGTTAGCATTTAAAACCTGG - Intergenic
1140157210 16:72443571-72443593 CAGAATTTTCATTTTAAAAAGGG - Intergenic
1141779196 16:86147371-86147393 CAAAAGTAAAATTTTAAAGCTGG - Intergenic
1141890234 16:86921446-86921468 CAGTATTCCCATGTGAAAGCTGG + Intergenic
1142558947 17:798659-798681 CAGAATTCCCCTTTTAGAGTGGG - Intergenic
1146798257 17:35798165-35798187 CAGAATAGACATTTTAGAGCAGG - Intronic
1147256692 17:39185941-39185963 GAGAATTACCTTCTTAAAGAAGG + Intronic
1149288621 17:55193903-55193925 AAGCATTAACATTTAAAAGCAGG + Intergenic
1149581468 17:57753367-57753389 GAGACTTTCCATTTTAAAACTGG + Intergenic
1149710024 17:58732915-58732937 AAGAATTAACATCTTAAAGTGGG - Intronic
1151010941 17:70495091-70495113 CATTATTTCCATTTTAAAGTAGG + Intergenic
1151136535 17:71951330-71951352 CACAATTACCATTTTAGATGAGG - Intergenic
1153229575 18:2923122-2923144 AAGAAATACAATTTTAAGGCTGG + Intronic
1153388478 18:4527692-4527714 CAGAATAAGCATTTAAAAGGCGG + Intergenic
1153750461 18:8224512-8224534 CAGATTGCCCATTTGAAAGCTGG + Intronic
1154026407 18:10711025-10711047 CTGACTGACCATTTTAAAACTGG + Intronic
1154309843 18:13258885-13258907 CAGAAGCACCATCTAAAAGCAGG + Intronic
1154947087 18:21172670-21172692 CAAAATTAACATTTTATGGCGGG - Intergenic
1156120912 18:33841705-33841727 CAGAATTACCGTGTGAAGGCAGG - Intergenic
1156429747 18:37059146-37059168 TATAATTACCATTTTACAGATGG - Intronic
1156735772 18:40257182-40257204 CAAACTAACCAATTTAAAGCCGG + Intergenic
1157609227 18:48945841-48945863 CAGAATTTGCTGTTTAAAGCTGG - Intronic
1157846550 18:51008905-51008927 CTGAATTTCCATTCTAAAGGAGG - Intronic
1158598152 18:58834474-58834496 CATAATTACCTCTTTAAAGAGGG - Intergenic
1159283819 18:66323071-66323093 ATGAATTAACATTTTAAAGTTGG + Intergenic
1159405296 18:67994333-67994355 CAGAAAAACCATTTTATTGCTGG - Intergenic
1160279438 18:77473805-77473827 CAGAATTTCTACCTTAAAGCAGG - Intergenic
1160494097 18:79359848-79359870 CAGAAATAGCATTCCAAAGCTGG + Intronic
1164155248 19:22591874-22591896 CATAATTCCCATTTTAAAGGTGG - Intergenic
1165083774 19:33328407-33328429 AATAAATACCATTTTTAAGCCGG - Intergenic
1165505850 19:36228708-36228730 CAGTATTACAATGTTAATGCTGG - Intronic
1165543235 19:36509685-36509707 CAGAATTATCATTTTTAAAGAGG + Intergenic
925370565 2:3342228-3342250 GAGAATTACATTTTAAAAGCAGG + Intronic
927062665 2:19439032-19439054 TATTATTACCATTTGAAAGCCGG - Intergenic
927702862 2:25278923-25278945 CAGAATCTGCATTTTAAAGAGGG - Intronic
928014592 2:27643880-27643902 AAGAATTACTATTTTTAGGCCGG + Intronic
930299869 2:49601985-49602007 CACAATTTCCATTTGAAAACAGG + Intergenic
930373572 2:50536052-50536074 CCGAATTTCCAATTTAAAACAGG - Intronic
933419849 2:82031184-82031206 CAGAATAAACATTTAAAAGGTGG - Intergenic
935493136 2:103745371-103745393 CAGAATTGTCACTTTTAAGCTGG + Intergenic
936754724 2:115693827-115693849 AAGCACTACCATTTTAAAGATGG - Intronic
937586551 2:123558362-123558384 AAGAAATACCATTTGAAGGCAGG - Intergenic
938082011 2:128375081-128375103 CAGCTTATCCATTTTAAAGCTGG + Intergenic
938451009 2:131420188-131420210 CTGAATTACCTTTTTAAAATAGG + Intergenic
939641289 2:144642928-144642950 GAGAATTAACATTCAAAAGCAGG - Intergenic
940146329 2:150548441-150548463 AAGAATCACCATTTTAAATTTGG - Intergenic
940777045 2:157895699-157895721 CAGAGTTGCCATTTAAAACCAGG - Intronic
941628189 2:167853806-167853828 CAGAATCTTCATTTTAAAGTAGG - Intergenic
942167006 2:173251554-173251576 CAAAATTAGAATTTTACAGCAGG - Intronic
943833200 2:192487852-192487874 CAGAATAAACATTTAAAAGGTGG - Intergenic
946168317 2:217878720-217878742 CTGAATTCCCATTTTACAGCAGG + Intronic
1169900251 20:10545421-10545443 CACATTTACTCTTTTAAAGCGGG - Intronic
1170276020 20:14589795-14589817 CAGATGTACCATTTTCCAGCTGG - Intronic
1172533122 20:35647756-35647778 AAGAATTACCATTTACCAGCTGG + Intronic
1173143508 20:40505379-40505401 TAGAATTTCCATTTTACAGATGG + Intergenic
1173974419 20:47176374-47176396 CTGAATTAAGAATTTAAAGCCGG - Intronic
1177752752 21:25306054-25306076 CAGAATTCTCATTTCAAAGCTGG - Intergenic
1177807138 21:25885460-25885482 CAGAATTTCCATTTTCCAACTGG + Intronic
1179276259 21:39894474-39894496 CACAATGACCAATTTAATGCAGG - Intronic
1179511029 21:41873742-41873764 CAGAGTTTCCATTTTTAAGATGG - Intronic
1179978446 21:44884145-44884167 CACAGTTACAATTTTAAAGTAGG + Intergenic
1181900417 22:26150587-26150609 CAAAATTACCAATTTAATGGGGG + Intergenic
1182404942 22:30118739-30118761 TATTATTACCATTTTAAAGCTGG - Intronic
1182420782 22:30247555-30247577 CAGCATTTCCATTCTGAAGCAGG + Intergenic
1182805679 22:33068263-33068285 AAGAATTTCCATTTCAAAGGTGG - Intergenic
1185160309 22:49222748-49222770 CAGCATTACAGTCTTAAAGCTGG - Intergenic
949228220 3:1719265-1719287 CAGAATGCCCTTTTTAAAGGGGG + Intergenic
949418225 3:3836501-3836523 CAGGACTTCCTTTTTAAAGCTGG + Intronic
949946900 3:9196929-9196951 CATGATTTCCATTTTAAAGAAGG + Intronic
950251648 3:11470619-11470641 CAGCATTCCCATTTTACAGATGG + Intronic
951993678 3:28703682-28703704 TAGAATGACCATTTGAAAGATGG - Intergenic
952302769 3:32118943-32118965 CAGAATTTCCTTTTTAAGGCTGG + Intronic
952668126 3:35932522-35932544 CTGATTTTCCATTTTAAAGGTGG + Intergenic
953738778 3:45518448-45518470 CAGAAATACAATTTTAGAGTTGG + Intronic
956377476 3:68631060-68631082 CAGAATTAGAATTTGAAACCAGG + Intergenic
956497853 3:69848091-69848113 CAGAAGAACAAATTTAAAGCTGG + Intronic
957036208 3:75295463-75295485 CCGAATATCCATTTTAAAGTGGG + Intergenic
958191282 3:90188177-90188199 CAGAAATACCATTTGACAGAGGG - Intergenic
958266150 3:91439739-91439761 TAGAATTAGGATTTAAAAGCTGG + Intergenic
959861704 3:111223705-111223727 CAAAATTACCAATTTTGAGCTGG + Intronic
959964715 3:112340254-112340276 CTGACTTACCATTTTATAGAAGG + Intronic
961079953 3:124017914-124017936 CTGAATATCCATTTTAAAGTGGG + Intergenic
961303181 3:125935215-125935237 CTGAATATCCATTTTAAAGTGGG - Intronic
961617546 3:128194675-128194697 CATAAATATCATTTTAAAGAAGG - Intronic
962210634 3:133474457-133474479 CATATTTTCCATTTGAAAGCAGG - Intronic
963482787 3:145897532-145897554 GAAAATTACCACTTTAGAGCAGG + Intergenic
963861836 3:150319423-150319445 CATAATAACCATTTTACAGATGG + Intergenic
964931333 3:162028256-162028278 CAGAGTGAACCTTTTAAAGCAGG - Intergenic
966143579 3:176785147-176785169 CAGAATTACAATTTTTCAACCGG + Intergenic
967012511 3:185449782-185449804 CAGTATTAGAATTTTAAAACTGG + Intronic
969100996 4:4768254-4768276 CATTATTACCATTTTACAGAGGG + Intergenic
970752652 4:19383499-19383521 CAGATTTTCCATTTGAAAGAAGG + Intergenic
970828201 4:20304036-20304058 CATAATTACCATTTTGAGGGTGG + Intronic
971051882 4:22871087-22871109 CAGACATACCATTTTAAACATGG - Intergenic
972135202 4:35884388-35884410 CAGAATTTCCATTGTAAAAGAGG - Intergenic
975073835 4:70179443-70179465 CAGAAGTAAAATTTTAAAGAGGG - Intergenic
975500627 4:75080457-75080479 GAGCATTACCATTTTAAAGAAGG - Intergenic
976784670 4:88804515-88804537 CAGAGTAACAATGTTAAAGCAGG - Intronic
978150969 4:105434328-105434350 CATAATTGCCAGTTTAAAGTTGG + Intronic
979309653 4:119187673-119187695 CAACATTATCATTTTAAAACAGG - Exonic
980131022 4:128815800-128815822 CAGAATTTGCATTATAAAACTGG + Intronic
980743209 4:136978531-136978553 CCGAATTGCCATTTTAATGAAGG - Intergenic
981998043 4:150996094-150996116 TGGAATTACCATTTCAAAGTAGG + Intronic
982910036 4:161128413-161128435 TAGAAATAATATTTTAAAGCTGG - Intergenic
982962530 4:161858605-161858627 TAGAATTACCATTTCAAAGGTGG - Intronic
983661356 4:170133372-170133394 CAGAATAAGCACTTTAAAGGCGG + Intergenic
984711075 4:182885679-182885701 CAGAATGCCCATTTAAAACCTGG + Intergenic
985047593 4:185956052-185956074 GAGGTTAACCATTTTAAAGCTGG + Intronic
986686772 5:10281771-10281793 CAACATTAACATTTTAAAGATGG - Intronic
988155203 5:27440897-27440919 TAGAATTATCATTCTAAAGTGGG + Intergenic
988294645 5:29340263-29340285 AAGAATTACAATATTAATGCAGG + Intergenic
988985911 5:36618815-36618837 CAGAAATAGCAATTAAAAGCAGG - Intronic
989763590 5:45050870-45050892 GAAAATTTCTATTTTAAAGCAGG - Intergenic
990058176 5:51611967-51611989 TAGAATTAACATTTTAGGGCTGG + Intergenic
990250306 5:53907235-53907257 CAGTATTCCCATTTTACAGATGG - Intronic
990936680 5:61157799-61157821 ATCAATTACCATTCTAAAGCTGG - Exonic
997175166 5:131767681-131767703 AAGGAGTACCATTTTAATGCTGG + Intronic
997835690 5:137191401-137191423 CAGAATTTCCATCATACAGCAGG - Intronic
999847201 5:155496780-155496802 CAGAAATACAAGTTTAAAGAAGG - Intergenic
1000919120 5:167117708-167117730 CATTATTACCATTGTAAGGCAGG + Intergenic
1002390949 5:178911072-178911094 CAGAATTTCCATTTTAACCAAGG - Intronic
1003939656 6:11011531-11011553 CTGAATTTTCATTTTAAAACTGG - Intronic
1004234908 6:13866463-13866485 CAGCATTACCATCTCAGAGCTGG + Intergenic
1004304781 6:14490042-14490064 ATGAATTGCCATTTTAAAGGCGG - Intergenic
1008594311 6:53025998-53026020 CAGAATTATGATTTGAAATCAGG - Intronic
1008628813 6:53344605-53344627 CAGCATTCCCATTTTACAGGTGG - Intronic
1008989124 6:57582234-57582256 TAGAATTAGGATTTAAAAGCTGG - Intronic
1009177658 6:60480475-60480497 TAGAATTAGGATTTAAAAGCTGG - Intergenic
1009256412 6:61408924-61408946 CAGAAATCCCATTTTAATGAAGG - Intergenic
1010261360 6:73820921-73820943 AAGAACTCCCATTTTAAAGCTGG - Intronic
1010974627 6:82297985-82298007 CAGAATAAGCATTTAAAAGGCGG + Intergenic
1011567150 6:88688278-88688300 CAGAATTAACATTTTGATGTTGG + Intronic
1011803291 6:91042918-91042940 TATAATTACCACCTTAAAGCGGG + Intergenic
1011809865 6:91118696-91118718 CAGAAAAGCCTTTTTAAAGCAGG - Intergenic
1012200574 6:96401378-96401400 CACAATTTCCATTTTAAATGAGG - Intergenic
1014972969 6:127841538-127841560 CAGAAAGATCATTTTAAAGGAGG - Intronic
1015116947 6:129660211-129660233 CAGAATTATCTTTCTAAAACAGG - Intronic
1021219952 7:17964028-17964050 CTGAGTTATTATTTTAAAGCAGG - Intergenic
1021439650 7:20663405-20663427 CAGAATTTCCTTTTAAAAACTGG - Intronic
1023964894 7:44958381-44958403 TAGAATTACCATTTGATGGCCGG + Intergenic
1027731392 7:81878079-81878101 CAGAATCAGCATTTAAAACCCGG - Intergenic
1028055738 7:86240228-86240250 TAGGATTAATATTTTAAAGCTGG - Intergenic
1029012911 7:97281625-97281647 CAGTCTTAGCATTTGAAAGCAGG + Intergenic
1029583343 7:101453058-101453080 CAGAATTATAATTTTAATGGGGG + Intronic
1030370659 7:108695645-108695667 CAGAATTAAAATTTTAAACTAGG + Intergenic
1030459264 7:109810079-109810101 CAGAATTTCAATTAAAAAGCTGG - Intergenic
1030504765 7:110407477-110407499 CAGAATTAACACTTTAAAACCGG - Intergenic
1030838673 7:114320312-114320334 CAGAGTTGGCTTTTTAAAGCAGG - Intronic
1031314716 7:120241604-120241626 AACAATTACCACTTTAAAGGAGG + Intergenic
1033669098 7:143472649-143472671 CAGAATAAGCGTTTTAAAGGTGG - Intergenic
1033717588 7:144018755-144018777 CAGAATCACAATTTTAATTCAGG - Intergenic
1033797866 7:144869441-144869463 CAGCATTACCCTTTTAATGCCGG - Intergenic
1036452054 8:8877425-8877447 CACAATTACCATTTTATTGTGGG - Intronic
1038875911 8:31548863-31548885 CAGAAACATCATTTAAAAGCAGG + Intergenic
1041222314 8:55664050-55664072 TAGAAATACCATTTGAAGGCTGG - Intergenic
1042694778 8:71544803-71544825 CAGAATTACGACTTGAAAACAGG - Intronic
1045103345 8:98867106-98867128 TATAATTACCATTTTAAAATGGG + Intronic
1047334836 8:123925536-123925558 CAGAATTGCCAATTTTCAGCTGG - Intronic
1048396379 8:134018055-134018077 CATAATTACCATTTTAACACGGG + Intergenic
1048753348 8:137704360-137704382 GAGAATTCCCAATTTATAGCTGG + Intergenic
1051234822 9:14988453-14988475 CAGAATTTCCTTTTTTAAGACGG - Intergenic
1052174372 9:25439805-25439827 GTGAATGACCATTTAAAAGCAGG + Intergenic
1054822684 9:69539187-69539209 CAGAATTGCCATTGTATAGACGG - Intronic
1054865386 9:69995068-69995090 CAGAAATCCCATTTTAAGGTAGG - Intergenic
1055223241 9:73964175-73964197 CACAATTTCCATTTGCAAGCTGG - Intergenic
1055361994 9:75501518-75501540 CAGAACTACCATTTTGACCCAGG - Intergenic
1055582167 9:77717691-77717713 CTGAATTACCTTTTTAAAATAGG + Exonic
1055909434 9:81330740-81330762 CAGAACTATAATTTTAGAGCTGG - Intergenic
1056375631 9:86007774-86007796 AAGAATCATCATTTGAAAGCTGG + Intronic
1056903308 9:90621718-90621740 CACAATTATAATTTTAAATCAGG + Intronic
1058096293 9:100863911-100863933 CATAACCACCATTTTAAAGATGG + Intergenic
1059668223 9:116469534-116469556 CAGAACTAGCATTTGAAAGCAGG - Intronic
1059784773 9:117569394-117569416 CAGAATTATCTTTGTAAAGAAGG - Intergenic
1060355157 9:122899850-122899872 CAGAATTAACATTTCCAAACAGG - Intronic
1060438287 9:123615246-123615268 CAGAACTACCATTTCACAGATGG + Intronic
1187852067 X:23600878-23600900 CAGAATTCCAATCTTTAAGCAGG + Intergenic
1188564293 X:31508314-31508336 CAAAGTTGGCATTTTAAAGCAGG - Intronic
1188735984 X:33716870-33716892 CTGAATGACCATCTTAAAACTGG + Intergenic
1188988213 X:36786974-36786996 CACTATTACAATTTTAATGCAGG - Intergenic
1191865440 X:65699940-65699962 GACAAGTACCATTTTAAAGAAGG - Intronic
1193832423 X:86305326-86305348 CAAAATTATCATTTTATATCAGG - Intronic
1194724785 X:97382562-97382584 TAGAATCATAATTTTAAAGCAGG - Intronic
1200286571 X:154828447-154828469 CAGAGTCACCCTTTGAAAGCAGG - Intronic