ID: 1119754712

View in Genome Browser
Species Human (GRCh38)
Location 14:77107710-77107732
Sequence AAATCTGTACTGAAGCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119754712_1119754713 -10 Left 1119754712 14:77107710-77107732 CCATGTAGCTTCAGTACAGATTT 0: 1
1: 0
2: 0
3: 18
4: 170
Right 1119754713 14:77107723-77107745 GTACAGATTTCCTAAAAACAAGG 0: 1
1: 0
2: 9
3: 52
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119754712 Original CRISPR AAATCTGTACTGAAGCTACA TGG (reversed) Intronic
901750025 1:11400365-11400387 AAATGTGCATTGAAGCCACATGG - Intergenic
903424310 1:23242220-23242242 AAAACTGGACCCAAGCTACAAGG + Intergenic
909379066 1:74976720-74976742 AAAACTGAAGTGAAACTACAGGG - Intergenic
909435154 1:75632221-75632243 AAGTCTGTACTGAAGAGGCAAGG - Intergenic
911757240 1:101572775-101572797 GAATCTGTACTGATGCAACCAGG - Intergenic
913718228 1:121561169-121561191 GAATCTTTGCTGAAGCCACAAGG - Intergenic
914764609 1:150626909-150626931 AAATCTGATCAGGAGCTACATGG + Intronic
916027194 1:160843413-160843435 AAATCATTACTAAACCTACAAGG + Intronic
916174333 1:162025009-162025031 AAATCTTTTCTGAAACTATATGG + Intergenic
916568049 1:165998835-165998857 ATATCTGTACAGATGCCACAGGG - Intergenic
916626335 1:166560194-166560216 AAATCTTAACTGTAACTACAGGG + Intergenic
917828274 1:178847648-178847670 AAATCTGTACTAAAGTAATATGG - Intronic
918694359 1:187525211-187525233 AATTCTGTATTGAAGCAACTTGG + Intergenic
918723442 1:187885551-187885573 AAAGCTGTATTGAGGATACAGGG + Intergenic
921359298 1:214315732-214315754 AAATGTGTACAGCAGTTACAAGG + Intronic
921435735 1:215118817-215118839 AATTCTGAACTGCAGGTACAAGG - Intronic
922040518 1:221891781-221891803 ATATCTGTTTTGAAGCAACATGG + Intergenic
923166556 1:231369437-231369459 AAATCTTTACAGAAGCAGCAGGG + Intronic
923356511 1:233161195-233161217 AAAGCTGTCATGGAGCTACAGGG - Intronic
924046461 1:240037052-240037074 AATTCTGCAGTGAAGCTACCTGG - Intronic
924817454 1:247455148-247455170 AAATCTCTGCTGAAGCTTGACGG + Intergenic
924823920 1:247520756-247520778 AAATCTGAACTGAAAATATAAGG - Intronic
1064852668 10:19726968-19726990 AACTCTGAACTGAAGCTCCATGG - Intronic
1066130690 10:32390573-32390595 AAATCTGTTCTGATGATACCGGG - Intergenic
1066213458 10:33263085-33263107 AAATCTGTAGAGAATGTACAGGG + Intronic
1066314754 10:34233340-34233362 AGATCAGTACAGAAGCGACAAGG - Intronic
1071963048 10:90824823-90824845 AAATCTGTGCTGGTGCCACAAGG - Intronic
1072295660 10:94007236-94007258 AAATCAGGACTGTAGCTCCAAGG + Intronic
1072677825 10:97481634-97481656 GAAGCTGGACTGAAGCAACAAGG + Intronic
1074425929 10:113351305-113351327 AAATGTTTACTGAAGATAGAGGG + Intergenic
1079893535 11:26089783-26089805 CAATCTGTACTTAAGTTACACGG + Intergenic
1080184709 11:29468167-29468189 AAATCTGTACTAAAGGCAAAGGG + Intergenic
1080867213 11:36205917-36205939 AAATCTGTACTGGAGACCCAGGG - Intronic
1081592345 11:44433238-44433260 ATAGCAGTACTGAAGCTATAGGG + Intergenic
1082840638 11:57686798-57686820 AAATATATACTGCAGATACATGG - Intronic
1085170562 11:74446151-74446173 AAATCTATACAGAATCTATAGGG - Intergenic
1091389425 12:117064-117086 TAGGCTGTACTGAAGCCACAGGG + Intronic
1092847632 12:12598685-12598707 AAATACGTAGTGCAGCTACATGG - Intergenic
1092862175 12:12728090-12728112 ACATCTGTAGTCCAGCTACATGG - Intronic
1093987364 12:25551329-25551351 AAACCTGTCCTGGAGCTATAGGG + Intronic
1098091813 12:66910463-66910485 AAATCTGTATTGAAACCAAAAGG + Intergenic
1098301228 12:69056052-69056074 AAATATGTTCTGACTCTACATGG + Intergenic
1100008350 12:89921886-89921908 AATTCTGTTCTGAAGTTACCAGG + Intergenic
1101540811 12:105663528-105663550 GAATCTGGACTGAAAGTACATGG - Intergenic
1103813027 12:123631094-123631116 GATTCTGTACAGATGCTACAGGG - Intronic
1106843882 13:33716643-33716665 AAATCAGCACTGAAGCTATTGGG - Intergenic
1108172789 13:47760530-47760552 AAATCTTTCCAAAAGCTACATGG - Intergenic
1109080256 13:57890607-57890629 TAAACTTTTCTGAAGCTACAGGG - Intergenic
1109990966 13:70057320-70057342 AAATCAGCAGTGAAGCTATAAGG - Intronic
1110794730 13:79623182-79623204 AAATCAACACTTAAGCTACAAGG - Intergenic
1111615865 13:90660977-90660999 CATTCTGTTCTGAAGATACATGG + Intergenic
1112572867 13:100609454-100609476 TAACCTGCACTTAAGCTACAGGG + Intronic
1112845236 13:103634611-103634633 AAATTTGTACTCAAGTTACACGG + Intergenic
1113629383 13:111871694-111871716 ACATCTGTACTGAAAAAACAAGG - Intergenic
1114372785 14:22109010-22109032 AACTCTGTATTAAAACTACAAGG + Intergenic
1114554801 14:23555871-23555893 AAAGCTGAACTGGGGCTACAAGG - Intronic
1115191728 14:30753801-30753823 AAATCTCTACTGAAACTTAAAGG - Intergenic
1116356108 14:43933290-43933312 AAATATGTACAAGAGCTACAAGG + Intergenic
1119754712 14:77107710-77107732 AAATCTGTACTGAAGCTACATGG - Intronic
1120430550 14:84409007-84409029 AAATCAGTATTGAATCTAAAAGG + Intergenic
1123832155 15:24151083-24151105 AAATCTGTAGAGAAGGTACAAGG - Intergenic
1128261818 15:66237992-66238014 ATATCTATACTGAAGCTACTGGG + Intronic
1128437511 15:67668986-67669008 ACATGTATACTGAAACTACAAGG - Intronic
1130375303 15:83323725-83323747 ACATCTGTGCTTAAACTACATGG + Intergenic
1131385390 15:92002174-92002196 ACATCTGGACTGAGGCTAAATGG - Intronic
1136012575 16:27373386-27373408 AAATCTGTACTGGAGTCGCATGG + Intergenic
1136232635 16:28895736-28895758 AAAACTGTACTCTAGCTACTAGG + Intronic
1136739147 16:32497948-32497970 AAATCTGGAATGAAGCTATCTGG + Intergenic
1137313426 16:47289452-47289474 AATTCAGTACTGAAGCTACTGGG + Intronic
1139156507 16:64449471-64449493 AAATCTGTACTGTAAATCCAAGG - Intergenic
1139726050 16:68899562-68899584 AGATCTGTACTGGCTCTACATGG - Intronic
1143697871 17:8633389-8633411 AATTCTGGGATGAAGCTACATGG - Intergenic
1146092518 17:29894077-29894099 AAAGCTGTACTGAAGCCATGAGG - Intronic
1149233255 17:54560959-54560981 AAATTTTTACTGAAGCTCGAAGG - Intergenic
1150116823 17:62558852-62558874 AAATTTTTAATGAAGCTACAAGG + Intronic
1156256941 18:35407764-35407786 AAATCTCTACTGAAGCTGTATGG - Intergenic
1156988881 18:43382169-43382191 ATGTCTGTACTGCAGCTACTTGG + Intergenic
1159107770 18:64023426-64023448 AAATCTTTAATGAAGATAAATGG - Intergenic
1159892348 18:73964541-73964563 CACTTTGTACTGAGGCTACATGG + Intergenic
1164014549 19:21241898-21241920 AAACCTGTAATGAAGATATATGG + Intronic
1166618505 19:44273126-44273148 AACTATGTAATAAAGCTACAAGG + Exonic
1167023004 19:46892596-46892618 AAGTATGTAATGAAGATACAGGG + Intergenic
926000467 2:9327541-9327563 AAATCTTCACTCTAGCTACATGG - Intronic
926715447 2:15920345-15920367 AAATATGTAAAGAAGCCACAGGG - Intergenic
927242547 2:20931402-20931424 AAATCTGGACAGAAGCCTCAGGG + Intergenic
929636482 2:43527144-43527166 AAATGTTTGCTGAGGCTACAAGG + Intronic
930218467 2:48721510-48721532 TAATCTGAGATGAAGCTACATGG + Intronic
930592500 2:53345618-53345640 AAATCTGCACTGAATCTTCCAGG - Intergenic
936814235 2:116440365-116440387 AAATCTGTACTAGAATTACATGG + Intergenic
941315035 2:163981476-163981498 AAATCTGTTCTGGAGGTACATGG - Intergenic
942381555 2:175396747-175396769 TAATTTGTGTTGAAGCTACATGG + Intergenic
942481996 2:176398454-176398476 TAAACTGTACTGAAGCTTAATGG - Intergenic
948371094 2:237489382-237489404 ACATCTGTGCTGTAGCCACAAGG - Intronic
1169533198 20:6507355-6507377 AAATCTGTGCTGGAGATTCAGGG - Intergenic
1171268336 20:23792937-23792959 AAATCTGTAGTGAAAATAGATGG - Intergenic
1172876367 20:38166721-38166743 AAATATCCACTGAAGCAACACGG - Intergenic
1173099275 20:40069529-40069551 AATTCAGCACTGAAGCTACTGGG - Intergenic
1175345136 20:58267700-58267722 AAATCTTTACTGAAACTACCAGG + Intergenic
1177444295 21:21171724-21171746 AAATCTTTTCTGTAGCTAAAAGG + Intronic
1177732379 21:25044219-25044241 AAAACTGTACTTAAGCCAGACGG + Intergenic
1177961572 21:27673275-27673297 AAAGCTGTACTGAAGGCACATGG - Intergenic
1179589771 21:42398849-42398871 AAATCGTTACTAAAGCTTCATGG - Intergenic
1184128557 22:42503677-42503699 AAATGTGAACTGAAGGAACAAGG + Intergenic
1184137351 22:42556992-42557014 AAATGTGAACTGAAGGAACAAGG + Intronic
1184385454 22:44171736-44171758 AGATCTGTGGGGAAGCTACATGG + Intronic
952351446 3:32542829-32542851 AAAACTGTTCTGAATTTACATGG + Intronic
955277252 3:57557811-57557833 AACTTTGTGCTGAAGATACAAGG - Intronic
956206795 3:66763072-66763094 AAATCTGTACAGCAGCTTCCTGG + Intergenic
958914026 3:100027478-100027500 AAGTCTGTTCCCAAGCTACAAGG - Intronic
961565091 3:127757936-127757958 AAATCTGTACGGGAGCTGCCTGG + Intronic
962933288 3:140057031-140057053 AAATCCCTATTGAAGCTGCAGGG - Intronic
964380117 3:156090159-156090181 AAAGCTGTAGAGAAGCTACATGG - Intronic
965589998 3:170353890-170353912 AAGTCAGTACTGGATCTACAAGG - Intergenic
965859207 3:173127282-173127304 AAATGTGCACTGAAGCTTTAAGG - Intronic
965907148 3:173723022-173723044 AGATAAGTCCTGAAGCTACAAGG + Intronic
967407384 3:189132741-189132763 AAATCTGATTTGAAGCTGCATGG + Intronic
967606672 3:191455166-191455188 AGACATGTACTGAAGCTGCATGG - Intergenic
968900298 4:3427979-3428001 AAAGCTGTAGAGAAGCCACAAGG - Intronic
969485422 4:7469991-7470013 AAAGATGTACTGAAGTCACAGGG + Intronic
971832198 4:31709400-31709422 AAATTTGTAATGAAGATACAAGG - Intergenic
972303148 4:37805189-37805211 AAAACTGCACTGAAGACACAAGG - Intergenic
973587434 4:52407610-52407632 TAATCTGTGCTTAAGCAACAGGG - Intergenic
975303307 4:72817590-72817612 AAATATGTACTGATTTTACAGGG + Intergenic
976052729 4:81028540-81028562 AAATATGCACTGTAGCTAAAGGG + Intergenic
976962016 4:90989170-90989192 AAATCTCTCCTGAAGCCAAAGGG - Intronic
977794763 4:101151160-101151182 AAATCTTGACTGAAGGTCCATGG - Intronic
979358246 4:119730983-119731005 AAATCTGCACTGATGCAACCAGG - Intergenic
982731570 4:158961273-158961295 CATTCTGAACTGAAGCTTCAGGG - Intronic
983392621 4:167152041-167152063 AAATATGTAATGAAGCCCCAAGG + Intronic
983760750 4:171403364-171403386 GAATCTGTAGTGATGCTACCAGG + Intergenic
983797003 4:171876321-171876343 AGAGTTGTACTGAAGATACACGG + Intronic
984337007 4:178405040-178405062 AAATCTGTACTTAGGCTTCATGG + Intergenic
985017854 4:185656249-185656271 AAATCTGTACAGCAGTTACTGGG - Intronic
986276684 5:6281371-6281393 AATTCTGAACTGTAGCTCCATGG - Intergenic
987517551 5:18932978-18933000 AAATCTAGACTGAAGATATAAGG + Intergenic
989513790 5:42318917-42318939 AAATCTGTACTAAAACTATTTGG - Intergenic
992246665 5:74831804-74831826 AAATCTGTGCTTAAGCTCTAGGG - Intronic
992502851 5:77358942-77358964 AAATACGTACTAAAGCTAAATGG - Intronic
993187524 5:84638063-84638085 AATACTTTACTGAAGCTTCAGGG - Intergenic
994971805 5:106748825-106748847 AAAACTGTTCTTAAGCTACTGGG + Intergenic
996957707 5:129204605-129204627 AAGTCTTTACGGAAGTTACATGG + Intergenic
997730978 5:136175627-136175649 CAATCTGTACTGTATCTACATGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1005148316 6:22718445-22718467 AAATCTTTGCTGAAACTAAATGG - Intergenic
1005205206 6:23394693-23394715 AAATCTGGATTGAACATACATGG - Intergenic
1009672247 6:66771128-66771150 AAATCCTTGCTAAAGCTACATGG - Intergenic
1010517623 6:76791919-76791941 AAGCCTGTACTGAAGAAACATGG - Intergenic
1013442912 6:110189820-110189842 AAATCTGTACTGAAAATATTTGG - Intronic
1013775211 6:113672032-113672054 GAATTTGTGCTGAAGCTAAAAGG - Intergenic
1014371105 6:120608716-120608738 AAATCTGCACTTAAGTAACAGGG - Intergenic
1015947510 6:138517943-138517965 ATACCTGTACTGTAGCTGCAAGG + Intronic
1015981000 6:138838560-138838582 TAATCTGTAATGAGGCTACTGGG + Intronic
1019884769 7:3894244-3894266 AAAACTGTTCTTAAGTTACAGGG - Intronic
1024954294 7:54900288-54900310 AAATCTGTACACAACCTTCAGGG - Intergenic
1027482888 7:78720975-78720997 AAATCTGAAATGGAGATACAGGG + Intronic
1027535875 7:79400534-79400556 AATTCTGCAGTGAAGCCACAGGG - Intronic
1029686085 7:102149227-102149249 AAATCTGTACTCATCCTCCAGGG + Intronic
1031604637 7:123753827-123753849 TAATCTGTACTGTTGCTACATGG + Intergenic
1032915786 7:136488324-136488346 AAATCTGGCCTGAAGCCACTGGG + Intergenic
1033740756 7:144274044-144274066 AAGTGTGAAATGAAGCTACATGG - Intergenic
1033753150 7:144375569-144375591 AAGTGTGAAATGAAGCTACATGG + Exonic
1035919149 8:3657889-3657911 AAATTTGCACAGAAGCTCCAGGG - Intronic
1035934876 8:3825717-3825739 AAATTTCCACTGAAGCAACAAGG + Intronic
1035941220 8:3903337-3903359 AAAAATGTACTCAACCTACAGGG + Intronic
1038262327 8:26007141-26007163 AAAACTTCACTGAAGCAACATGG - Intronic
1041083213 8:54233348-54233370 GAATCTGTACTGAGGCAACCAGG + Intergenic
1041787247 8:61648794-61648816 AAAACTGTGCTAAAGCCACATGG + Intronic
1042500037 8:69498839-69498861 AAGTCTGTACTGGAGCTCCATGG - Intronic
1043008568 8:74852588-74852610 AACTCTGTGCTAAAGCTGCATGG - Exonic
1043111908 8:76196160-76196182 AAATCTAGACTGATGCTAAAAGG + Intergenic
1046065413 8:109190734-109190756 AAATCCATAGGGAAGCTACATGG - Intergenic
1047659878 8:127021606-127021628 AAATCAGTCCTGAAGATGCAGGG - Intergenic
1051651429 9:19330273-19330295 AAATATGTACTGAAGTGTCATGG + Intronic
1052189233 9:25638258-25638280 ATATATGTACTGAAGCAACTAGG + Intergenic
1052440502 9:28490555-28490577 AAATCTGTAATGAAGGAACCTGG - Intronic
1054696115 9:68360776-68360798 AAATCTGTACTAAAGATTTAGGG - Intronic
1055717584 9:79134876-79134898 AATTCTGTAATCAAGCCACAAGG - Intergenic
1058418708 9:104815049-104815071 AAATTTATTCTGAACCTACAGGG + Intronic
1185510054 X:657288-657310 AAATCTGCCCTGCAGTTACAGGG - Intronic
1187480505 X:19650712-19650734 AAATCTGTACTGAACAGAAAGGG - Intronic
1187745572 X:22405498-22405520 AACATTGTACTGATGCTACAGGG - Intergenic
1188060403 X:25594310-25594332 AACTCTGGAGTGAAGCCACATGG - Intergenic
1188417837 X:29957978-29958000 AAACCAGAACTGAAGCTGCAAGG + Intergenic
1188809289 X:34633005-34633027 AAATCTGTACTGATCCTACCAGG + Intronic
1188830474 X:34890616-34890638 AAATCTTTTCTGAAACAACATGG + Intergenic
1191883757 X:65867909-65867931 AAATCAGTATTGAAGATATATGG - Intergenic
1193528921 X:82629776-82629798 AATTCAGTAGTGAAGCCACAAGG - Intergenic
1193802859 X:85957592-85957614 ATATCTGCACTGTAGCCACATGG + Intronic
1198372031 X:135999126-135999148 AAATTTGTGCTGAAGCCAAAAGG - Intronic