ID: 1119755765

View in Genome Browser
Species Human (GRCh38)
Location 14:77118155-77118177
Sequence TTTGCAAACAGGCCGTCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119755765_1119755767 3 Left 1119755765 14:77118155-77118177 CCTTAGGACGGCCTGTTTGCAAA 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1119755767 14:77118181-77118203 GTTTCATCCACATTTTTTTATGG 0: 1
1: 0
2: 4
3: 58
4: 498
1119755765_1119755769 26 Left 1119755765 14:77118155-77118177 CCTTAGGACGGCCTGTTTGCAAA 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1119755769 14:77118204-77118226 CATCCCTGCAGATTGTAGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119755765 Original CRISPR TTTGCAAACAGGCCGTCCTA AGG (reversed) Intronic
900337484 1:2171832-2171854 TTTGACAGCAGGCCATCCTAAGG + Intronic
905913537 1:41670042-41670064 TCTGCAAAGAGGCCCTCCCAGGG - Intronic
908334217 1:63103867-63103889 TTTGAAAACAGAGCCTCCTAGGG + Intergenic
909784343 1:79592311-79592333 TTTGCATACAAGCCTGCCTAAGG + Intergenic
917707514 1:177649148-177649170 TGTGGAAACAGACCGCCCTAGGG - Intergenic
923586719 1:235279629-235279651 TTTGCAAGCAGCCCTTTCTAAGG - Intronic
1065435433 10:25700091-25700113 TTGGCAAACAGTGCTTCCTAAGG - Intergenic
1067194241 10:44101570-44101592 CTTGCAAACAAGGCTTCCTAAGG + Intergenic
1067665320 10:48272945-48272967 ATTGCAAACAGGCTGACCAAGGG + Intronic
1070597656 10:77843972-77843994 CTTGCAAGCAGGCCTTTCTAAGG - Intronic
1085232652 11:74986024-74986046 CTTGCAAGCAGGCCTTCCTAAGG + Intergenic
1085421840 11:76369495-76369517 TTAACAAACAGGCCTTTCTAAGG - Intronic
1086335737 11:85798986-85799008 CTTGCAAGCAGGCCTTTCTATGG + Intronic
1095196729 12:39328078-39328100 TTTCCAAGCAGGCCTTTCTAAGG - Intronic
1095590020 12:43892552-43892574 TTTGCAAGCAGGCTTTTCTAAGG + Intronic
1097971002 12:65632969-65632991 CTTGCAAGCAGGTCTTCCTAAGG - Intergenic
1100435713 12:94569773-94569795 TTTGCAAACAGCTCTTCTTAGGG - Exonic
1102088793 12:110168839-110168861 TTTGCAAGCAGACCTTTCTAGGG - Intronic
1104422627 12:128649754-128649776 TTATTAAACAGGCCGTCCTTTGG - Intronic
1106052908 13:26208137-26208159 CTTGCAAACAAGCCTTTCTAGGG - Intronic
1119755765 14:77118155-77118177 TTTGCAAACAGGCCGTCCTAAGG - Intronic
1120307494 14:82789332-82789354 TTTACAATCAGGCCATCTTAGGG + Intergenic
1126819937 15:52492647-52492669 CTTGTAAACAGGCCTTCCAAAGG + Intronic
1128881338 15:71245870-71245892 CTTGCAAACAGGCCTTTCTAAGG + Intronic
1129058311 15:72838088-72838110 TTTGCTAACAGCCCATCATAGGG + Intergenic
1138569169 16:57857278-57857300 TTTGGAAACAGGCTGTGCTAAGG - Intronic
1139903907 16:70349511-70349533 CTTGCAAATAGGCTTTCCTAAGG + Intronic
1141287696 16:82687828-82687850 TTTTCAAACTGGCTGTCCTCGGG + Intronic
1146840037 17:36145171-36145193 TTTGCAAGCAGGCCTTTCTAAGG - Intergenic
1157514442 18:48300853-48300875 TTTGCAGCGAAGCCGTCCTATGG - Intronic
1159549907 18:69884133-69884155 CTTGCAGGCAGGCCGTCCTAAGG + Intronic
1162963351 19:14142203-14142225 CTTGCAAACAGGTCTTTCTAAGG - Intergenic
1163853065 19:19677479-19677501 TTGGTAAACAGGCCTTTCTAAGG + Intronic
1165325349 19:35111493-35111515 ATTGCAAACTGGCGGTCCCAGGG - Intergenic
926882581 2:17563342-17563364 TTTGCAAACAAGCCATGCTGTGG - Intronic
927576975 2:24208303-24208325 TCTGCACCCAGGCGGTCCTACGG + Exonic
928516680 2:32050798-32050820 TTTGCAAGCAGGCCTTTCCAAGG - Intergenic
929775083 2:44925295-44925317 ACTGCAGACAGGCCATCCTAAGG + Intergenic
937399149 2:121566531-121566553 TCTGCAAACAGGACTTCCTTAGG + Intronic
943182298 2:184560170-184560192 TTTGTAGACAGGTCGTCCCATGG + Intergenic
945113683 2:206389813-206389835 CTTGCAAGCAGGCCTTTCTAAGG - Intergenic
1169167135 20:3433785-3433807 TTGGAAAACAGGCCTTCCTGGGG - Intergenic
1172493397 20:35359946-35359968 TTTGCCCACAGGCTGTCCTGTGG - Intronic
1172781271 20:37438230-37438252 TTTGTAAACAGACCCTCCTGAGG - Intergenic
1173237586 20:41261697-41261719 TTTGCCAACAGCCAATCCTAAGG + Intronic
1180883810 22:19225354-19225376 TTTGCAGGAAGGCCGTCTTAAGG + Intronic
952698231 3:36295650-36295672 TCTGAAAACAGGCCTTCCTGGGG + Intergenic
953484519 3:43282842-43282864 GTTGCAAATAGGCAGTCCCAGGG - Intergenic
955885434 3:63593000-63593022 TTTGAAATCAGGCAGTCCTGAGG - Intronic
956966214 3:74463961-74463983 TTTGTAAACAGGCATTCCTCAGG + Intronic
957386633 3:79503872-79503894 TTGGCAAAATGGCCGTCTTATGG + Intronic
958699763 3:97573272-97573294 TTTGCTAACAGGCCTTCATCAGG - Intronic
960275026 3:115719310-115719332 TTTACAAACAAGCCTTTCTAAGG - Intronic
969063131 4:4455475-4455497 CTTGCAAGCAGGCCTTTCTAAGG - Intronic
970873142 4:20839929-20839951 CTTGCAAGCAGGCCTTTCTAAGG - Intronic
974217291 4:58866662-58866684 TCTGCAGCCAGGGCGTCCTAAGG + Intergenic
977750437 4:100603394-100603416 TTTGAAAACAGATTGTCCTAAGG + Intronic
980973643 4:139589680-139589702 TTTGCAAACAGGTCTTTCTAAGG + Intronic
981740033 4:147991749-147991771 TTTGCAGGCAGGCCTTTCTAAGG + Intronic
987267474 5:16272082-16272104 TATGCAAACAGCTCGTCCTCAGG + Intergenic
991152541 5:63387449-63387471 TTTGCAACCAAACCGTTCTAAGG - Intergenic
993859471 5:93117579-93117601 TTTTCAAACAGGAAGTCTTATGG - Intergenic
994397781 5:99240201-99240223 TTTGCAAACAGCCCTTTTTAAGG + Intergenic
997160900 5:131608375-131608397 TTTACAAATAGGTCTTCCTAAGG + Intronic
1001096733 5:168781122-168781144 TTTTCAGACAGGCCGCCCAATGG - Intronic
1005380737 6:25231787-25231809 TTGGGAAACAGGCCTTCCTGTGG + Intergenic
1008144820 6:47878560-47878582 TTTGCAAAATGGCTGTCCCATGG + Exonic
1018177838 6:161193482-161193504 TTTGCAAGCAGGCCGCTCTGTGG + Intronic
1021869614 7:24991518-24991540 CTTGCAAGCAGGCCTTTCTAAGG + Intergenic
1029452465 7:100648800-100648822 TTTGCAAACGGGCGGTCCACTGG - Exonic
1034010820 7:147527736-147527758 TTTGTAAAAAGGGCTTCCTAAGG - Intronic
1034254558 7:149717371-149717393 CTGGCAAGCAGGCCTTCCTAAGG + Intronic
1042871621 8:73405150-73405172 GTTGCAAACTGGCCGCCCTTGGG - Intergenic
1043704527 8:83331604-83331626 TTTTCCTACAGGCCCTCCTAAGG + Intergenic
1045015307 8:97996416-97996438 CTTGCAAACAGGCCCACCTGGGG - Intronic
1047461302 8:125068144-125068166 CTTGCAAACAGGCCTCTCTAGGG - Intronic
1048133552 8:131723421-131723443 TTTGCAAGCAGGTCTTTCTAAGG + Intergenic
1048294643 8:133205485-133205507 TTTGCAAACACACTGTCATATGG - Intronic
1048779156 8:137982400-137982422 TTTGCAAGCTGGCTGTCCTGGGG - Intergenic
1051779050 9:20669011-20669033 TCTCCAAACAGGACTTCCTATGG - Intronic
1052043081 9:23763123-23763145 TTTGCAAACAGACCAGCCCAAGG + Intronic
1052244184 9:26313735-26313757 TTTGCAAGCAGGCCTTTCTAAGG - Intergenic
1056187829 9:84153895-84153917 TTTGCAAACAGGCTTTTCTAAGG - Intergenic
1060870722 9:127037877-127037899 CTTGGAAACAGGCCTTCCTATGG + Intronic
1186516773 X:10172087-10172109 CTTGCAAACAGGCCTTTCTAAGG + Intronic
1190424371 X:50318691-50318713 CTTGCAAACAGACCTTTCTAGGG - Intronic
1195935059 X:110117313-110117335 TTTGCCAAAAGGCGGTCATATGG - Intronic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1199568285 X:149240994-149241016 TTTGAAATCAGGCAGTCCGATGG - Intergenic