ID: 1119756298

View in Genome Browser
Species Human (GRCh38)
Location 14:77122255-77122277
Sequence CAGAAGAAGGAGAAATGTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 384}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119756298 Original CRISPR CAGAAGAAGGAGAAATGTTC GGG (reversed) Intronic
900501722 1:3009120-3009142 CAGAAGGAGGAGGTATGTCCTGG + Intergenic
901241740 1:7698214-7698236 CAGAAGAAGAAGAATTGTCTTGG + Intronic
902741769 1:18443746-18443768 TAGCAGAAGCAGAAATGTTAGGG - Intergenic
904101112 1:28028562-28028584 AAGAAGAAGAAGAAATCATCTGG - Intronic
904412361 1:30332183-30332205 CAGGTGCAGGAGGAATGTTCTGG - Intergenic
905920047 1:41713214-41713236 CAGAAGAGGGAGTGATGCTCTGG - Intronic
907236265 1:53051661-53051683 CAGAATAAAGAGAAACGTTGGGG + Exonic
907653461 1:56318843-56318865 CAGAAAAAAGATAAATGTCCAGG - Intergenic
908267323 1:62392310-62392332 CTGAATAAGGATAAATGTTGAGG - Intergenic
908444610 1:64189180-64189202 CACAAGAAGGTGAACTGTTCTGG - Intergenic
909055876 1:70820533-70820555 AAGAGGAAGGACAAAGGTTCAGG + Intergenic
909201963 1:72701047-72701069 CAGAGGAAAGAGAAATGCTTGGG + Intergenic
909326370 1:74355739-74355761 AAGGAGAAGGAAAAATGTACAGG + Intronic
909369725 1:74870036-74870058 CAGCAGAAGGTGAAATGGTTGGG - Intergenic
910442178 1:87264147-87264169 CAGAAAAAAGAAAAATGTTTTGG - Intergenic
910490257 1:87761478-87761500 TACTTGAAGGAGAAATGTTCGGG + Intergenic
910983799 1:92984548-92984570 CAGAAGAAGGGAAAATTTCCGGG + Intergenic
913370469 1:118093483-118093505 AAGAAGAAGAAGAAAGGTTCAGG - Intronic
913692523 1:121292876-121292898 TAGAAGAAGGGGAAATATTGGGG + Intronic
914145033 1:144987218-144987240 TAGAAGAAGGGGAAATATTGGGG - Intronic
914982317 1:152425602-152425624 AAGAAGAAGAAGAACTTTTCAGG - Intergenic
915816662 1:158974327-158974349 TAAAATAAAGAGAAATGTTCAGG - Intronic
915874312 1:159596069-159596091 CAGGAGGAGGAAAAATCTTCTGG - Intergenic
916636106 1:166670427-166670449 CAAAAGGAGGAGAAAAATTCAGG + Intergenic
917198617 1:172492729-172492751 CAGAAGAAAAAGAAATGTTTAGG + Intergenic
917572190 1:176279222-176279244 CAGGAGCAGGAGAAATGTGTAGG + Intergenic
918157441 1:181862903-181862925 GAGAAGATGAAAAAATGTTCTGG + Intergenic
918629580 1:186700338-186700360 CACAAAAAGAAGACATGTTCTGG - Intergenic
918738852 1:188102149-188102171 TAGAAGAATTAGATATGTTCAGG + Intergenic
919491997 1:198215535-198215557 CAGAAGAAGAAGAATTGTCTTGG - Intronic
920479842 1:206311233-206311255 TAGAAGAAGGGGAAATATTGGGG + Intronic
921042715 1:211448925-211448947 CAGAACAAAGAGAAATACTCTGG + Intergenic
922322109 1:224498018-224498040 CAGAAGGAGGAAGAATCTTCAGG + Intronic
923084952 1:230696111-230696133 CAAAGAAAGGAGAGATGTTCTGG - Intergenic
924167841 1:241303693-241303715 CAGAAAAAAGAGAGATGTTGGGG - Intronic
924534469 1:244922794-244922816 CACATGTAGGAGAAATGCTCTGG - Intergenic
1063257094 10:4340398-4340420 CAGAGCAAGGACAAATGTTCTGG - Intergenic
1063945284 10:11170015-11170037 CAGAAGAAGGATAGAGGTTGTGG + Intronic
1064349894 10:14567260-14567282 CAGAAAAATGAGAAAAGTACAGG + Intronic
1064571450 10:16697816-16697838 CAGAAGAAGGAAAGATATTTAGG - Intronic
1065750424 10:28881098-28881120 CAGAAGAAGAAGAATTGTCTTGG - Exonic
1066067112 10:31770449-31770471 CAGAACAAACAGAAATGTGCAGG + Intergenic
1067486636 10:46656715-46656737 CGGAAGAAGGAGAATTGTCTTGG + Intergenic
1067608115 10:47684947-47684969 CGGAAGAAGGAGAATTGTCTTGG - Intergenic
1068368746 10:56086615-56086637 CAAAAGGAGGAAAAATGGTCAGG + Intergenic
1068690552 10:59909525-59909547 AAGAAGGAGGAGAAATGATAGGG - Intergenic
1069378586 10:67819336-67819358 AAAAAGAAAAAGAAATGTTCGGG + Intronic
1069788600 10:71005322-71005344 CTGAGGAAGGAGCACTGTTCTGG - Intergenic
1069968022 10:72137847-72137869 AAGAAGAAGAAGAAATATTATGG - Intronic
1070018781 10:72562911-72562933 GAGAAAAAGAAGAAACGTTCTGG - Exonic
1070767113 10:79063161-79063183 CAGAAGGAGGAGAGATGCTGAGG + Intergenic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1071499976 10:86196355-86196377 AAGAAAAACGAGAAATGGTCTGG + Intronic
1072112530 10:92336819-92336841 AAGAAAAACGAGAGATGTTCTGG + Intronic
1072527874 10:96289926-96289948 CAGGGGAAGGAAAAATGTCCAGG - Intergenic
1073000518 10:100282080-100282102 CTGAAGAAGTAGAAGTGTTTGGG - Intronic
1073028811 10:100508479-100508501 CAGAAGAAAGAGAAAAGGCCAGG + Intronic
1073063047 10:100743683-100743705 CCGAAGAAGGAAAACAGTTCGGG - Intronic
1073186691 10:101619249-101619271 CATCAGAAGCAGAAATATTCTGG + Intronic
1074491238 10:113941532-113941554 AAGAAGCAGGAGAAATGGGCTGG - Intergenic
1074924246 10:118051086-118051108 CTGTAGAAGCAGCAATGTTCTGG - Intergenic
1076729596 10:132431784-132431806 CTGGAGAAGGAGAAATATTCTGG + Intergenic
1077669092 11:4141424-4141446 AAGCAGAAACAGAAATGTTCAGG - Intergenic
1077943701 11:6871724-6871746 TATAAGAAGGAGAAATCTTGTGG - Intergenic
1078407186 11:11080683-11080705 CAGCAGAAAGAGACAGGTTCAGG - Intergenic
1078525724 11:12099761-12099783 TATAAGAAAGAAAAATGTTCTGG + Intronic
1078837441 11:15044533-15044555 AAGAAGAAGCAGAAATGCCCTGG - Intronic
1079262006 11:18891499-18891521 CAGAAGAAGGAGGAAAGGTAAGG - Intergenic
1079720379 11:23804478-23804500 CAGAAGAAGGAAAACTCTTGAGG - Intergenic
1079795918 11:24802895-24802917 TAGAAGAAGGAGAAAGGATGAGG - Intronic
1080535999 11:33222354-33222376 AAGAATAATGAGAAAAGTTCAGG - Intergenic
1080871919 11:36243816-36243838 CAAAAGATGAAGAAATATTCTGG + Intergenic
1083237687 11:61362104-61362126 CAGAGGAGGCGGAAATGTTCAGG + Exonic
1083817770 11:65146572-65146594 CAAAAGAAGGAGAAACCTTTGGG - Intergenic
1084625636 11:70304285-70304307 CAGCAGAAGGAGAGATGCACAGG - Intronic
1085334827 11:75684583-75684605 AAGAAGAAGAAGAAAACTTCAGG - Intergenic
1085634982 11:78151976-78151998 CAGATGATGGTGGAATGTTCTGG - Intergenic
1086585535 11:88447240-88447262 CAGAAGAAGGAAGAATTTTGAGG + Intergenic
1087035157 11:93748533-93748555 CAGAAAAAGTAGAAATTTTATGG + Intronic
1087660817 11:100986037-100986059 GAGAAAAAGGAAAGATGTTCTGG - Intronic
1089963568 11:122636960-122636982 CAGATGAAGGAGGATTGTCCAGG - Intergenic
1090869517 11:130730935-130730957 CAGAAGAAGAAGAATTGTCTTGG - Intergenic
1091240491 11:134048984-134049006 CAATAGAAAGAAAAATGTTCAGG + Intergenic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092593304 12:9972150-9972172 AAGAAGTAGGAGAAATTTTAGGG - Intronic
1092894200 12:12997546-12997568 GAGAAGGAGGAGAAATACTCTGG + Intronic
1093235478 12:16604864-16604886 CAGAAAAAGGAGAAAAGTTTTGG - Intronic
1093500642 12:19808052-19808074 CAAAAAAAGGATAAATGTTTAGG - Intergenic
1093746352 12:22745776-22745798 GAGAAGAAGGAGAGAGGTTAGGG - Intergenic
1093866049 12:24228739-24228761 GAAATGAAGGAGAAATATTCAGG - Intergenic
1095100269 12:38174623-38174645 TAGGAGAAGGAGAAAAGTTAGGG - Intergenic
1095123590 12:38447286-38447308 CAGAAGGATTACAAATGTTCTGG + Intergenic
1095719300 12:45383457-45383479 CAAAATAAGCAGAAATCTTCTGG - Intronic
1097088145 12:56484508-56484530 CAGAAGCAGGAAAACTCTTCTGG - Intronic
1099203551 12:79702703-79702725 CCGAAGTAGGAGAATTGTTGAGG + Intergenic
1099326560 12:81223316-81223338 CTGAAGAATGAGAAATTGTCAGG - Intronic
1100916245 12:99426650-99426672 AAGAAGATGGAAAAATTTTCTGG - Intronic
1101014410 12:100484712-100484734 TAAAAGAAGGAGAAACATTCAGG - Intronic
1101193952 12:102363508-102363530 AAAAAGGAGGAGAAATGCTCTGG - Intergenic
1101256655 12:102984456-102984478 CAGGAGCAGGAGAAATGGTCTGG + Intergenic
1101851165 12:108403514-108403536 CAGAAGAAGGAAAAAAGGCCAGG - Intergenic
1102019687 12:109673658-109673680 ATGAAGAAGCAGAAATGTTGGGG - Intergenic
1102909192 12:116699694-116699716 CTGGAGAAGGGGAAATGTTTTGG - Intergenic
1103861387 12:124017268-124017290 CAGAATATGCAGAAATCTTCAGG + Intronic
1104072164 12:125355303-125355325 CAGAGGAATGAGAAAGCTTCAGG + Intronic
1104075707 12:125387890-125387912 CAAAAGAAGGAAAAGTCTTCGGG + Intronic
1107417379 13:40213125-40213147 AAGAAGAAAGAAAAATGGTCTGG + Intergenic
1108008588 13:45978901-45978923 CAGAAGTAGGAGAATTGATTAGG - Intronic
1108269749 13:48748183-48748205 CAGAAGAAACAAAAATGATCAGG + Intergenic
1108376834 13:49821880-49821902 CACAAGAAGCAGTACTGTTCAGG + Intergenic
1109692589 13:65912351-65912373 TAGAAGATGGAGAAATTTTGTGG - Intergenic
1110102458 13:71626577-71626599 GATAAGAAGGAAAAATGTCCTGG - Intronic
1110142310 13:72145563-72145585 CTGAAGAATGAGAAAAATTCAGG + Intergenic
1110429729 13:75410355-75410377 TAGAAGAAGAAGCACTGTTCTGG - Intronic
1110568118 13:76976600-76976622 CAGAAAGAAGAGAAATGTGCTGG - Intergenic
1110675019 13:78232125-78232147 AAGAATAAATAGAAATGTTCTGG - Intergenic
1112293833 13:98168822-98168844 AAGAAGTAGTTGAAATGTTCAGG + Intronic
1113491270 13:110693905-110693927 TGGAAGAAGGTGAAATGTTGAGG - Intronic
1113660098 13:112101388-112101410 CAGATGAAAGAGTAATGTTCTGG + Intergenic
1114846873 14:26333059-26333081 CAGAAGATGTAGAAATCTACTGG - Intergenic
1115917210 14:38329312-38329334 AAGAAGAAGGAGAAAGGATTTGG + Intergenic
1116479941 14:45385474-45385496 CGGAAGAAGGAGGAAGGTCCTGG + Intergenic
1116942491 14:50804296-50804318 CAGAAAAAGCAGAGATGCTCAGG + Intronic
1117060928 14:51962698-51962720 CAGAAAAGGGAGAGATTTTCTGG + Intronic
1117134899 14:52725617-52725639 AAGATAAAGGAGAAATGATCAGG - Intronic
1117719722 14:58617590-58617612 GAGAAGGATGAGAAACGTTCTGG - Intergenic
1118567207 14:67154764-67154786 TAGCAGAAGCAGAAATCTTCAGG - Intronic
1119756298 14:77122255-77122277 CAGAAGAAGGAGAAATGTTCGGG - Intronic
1121173577 14:91873934-91873956 CAGAAGAAGGAGCAAGGTCATGG - Intronic
1121445945 14:93979009-93979031 CAGAGGAAAGAGAACTGTGCTGG + Intergenic
1122189862 14:100032746-100032768 CAGAAAAAAGAGAAATTTTGTGG - Intronic
1125313920 15:38410723-38410745 CAGAAGCAGGGGAAATGGTGAGG + Intergenic
1126145013 15:45465912-45465934 CAGAAGAAGGAGGGATGTGCTGG + Intergenic
1126483062 15:49148738-49148760 CAGAATAAGGAGAAAAGTTAGGG + Intronic
1127601462 15:60541646-60541668 CATAAGGAGAAGAAATGCTCTGG + Intronic
1128631401 15:69272212-69272234 GAGAAGAAAGAGAAATATCCAGG - Intronic
1128882855 15:71259422-71259444 AAGAAGAAGGAACAAGGTTCTGG + Intronic
1131712514 15:95071526-95071548 CAGGAGGAGGAAAAATGTGCAGG - Intergenic
1131780671 15:95854789-95854811 GAGAAAAAGGAGAAATGCTATGG + Intergenic
1132031292 15:98440092-98440114 TAGAGGAAGCAGAAATGTCCAGG - Intronic
1132303968 15:100795201-100795223 CAGAAGAAGGTGAAATAAACTGG - Intergenic
1133110793 16:3546954-3546976 CTGAAGGAGAAGAAATGGTCAGG + Intronic
1133312724 16:4860692-4860714 AAGAAGAAGAAGAAATATTCTGG + Exonic
1133444886 16:5851493-5851515 CCGAAGAAGATGAAATGCTCAGG + Intergenic
1134296621 16:12951872-12951894 CTGAAGATGGAGAAATATGCAGG + Intronic
1134861145 16:17561592-17561614 CAGCAGAAGGAAGAATGTTCTGG - Intergenic
1135259299 16:20966970-20966992 CAACAGAAGGAGCATTGTTCCGG - Intronic
1136062523 16:27736523-27736545 CAGAAGAAGGAGCAAGGCTGTGG + Intronic
1137738828 16:50744942-50744964 CTGATGAAGGAGAACAGTTCAGG - Intronic
1137779035 16:51081512-51081534 AGGAAGAAGGAGAAATGCACTGG - Intergenic
1138159168 16:54737229-54737251 AAGCGGAGGGAGAAATGTTCAGG + Intergenic
1138264870 16:55653101-55653123 CAAAAGAAAGAGAACTCTTCTGG + Intergenic
1138999351 16:62490399-62490421 CAGAAGAAGAAGCAAGGCTCAGG - Intergenic
1140242103 16:73212038-73212060 CAGAAGAATTATTAATGTTCAGG - Intergenic
1140783104 16:78314445-78314467 CAGCAGGGGGATAAATGTTCAGG - Intronic
1141539496 16:84708597-84708619 AAGAAGATGGAGAAAAATTCAGG - Intronic
1144234298 17:13242301-13242323 CAGGAGAATGAGAAGTGTTCTGG + Intergenic
1146538428 17:33673527-33673549 CAAAAGGAGGAGTGATGTTCAGG + Intronic
1148931883 17:51133649-51133671 CAGAAGAAGAGGACATATTCAGG + Intergenic
1151138649 17:71971260-71971282 TAGAAGATGGAGAAATGGTCTGG + Intergenic
1153074784 18:1149366-1149388 CAGAAGAAAAAATAATGTTCTGG - Intergenic
1154933111 18:21021266-21021288 CAGAAGAGAGAGAAAGATTCAGG + Intronic
1155517810 18:26640661-26640683 TATAGGAGGGAGAAATGTTCAGG + Intronic
1156201055 18:34832227-34832249 GAAAAGAATGAGAAATCTTCAGG - Intronic
1157182779 18:45512150-45512172 CAGCAGAAAGAGAAATGCTTGGG + Intronic
1157393332 18:47321551-47321573 CAGAAGCAGGAGAATTGCACTGG + Intergenic
1157943784 18:51956581-51956603 CAGAAGAAGAACAAAAGTTGGGG + Intergenic
1158188981 18:54803997-54804019 AAGAAGAGGGAGAAATAATCAGG - Intronic
1158357612 18:56638510-56638532 GAGAGGAAGGAGAGATGCTCAGG + Exonic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1158864269 18:61622611-61622633 CAGAATAGAGAAAAATGTTCAGG + Intergenic
1159044824 18:63359313-63359335 CCTAAGAAGTAGAAATGATCAGG - Intronic
1159130307 18:64273778-64273800 CAGAAGAAAGAGAATTGTCACGG - Intergenic
1159853952 18:73561917-73561939 GAGAAGATGAAGAATTGTTCTGG - Intergenic
1164336297 19:24324355-24324377 CAGAAGGAGCAGAAATATACTGG - Intergenic
1164518050 19:28953260-28953282 CAGAGGAGGGAGAATTGTTAAGG + Intergenic
1165617251 19:37212779-37212801 CAGAAGAAAGAGAAAACTACAGG - Intronic
1168421467 19:56206825-56206847 GAAAAGAGGGAGAAATATTCTGG - Intronic
925038318 2:709281-709303 AAGAAGAAGGTGGAAGGTTCTGG - Intergenic
926053374 2:9758697-9758719 CATAAAAATGAGAAATGTTATGG + Intergenic
927312787 2:21649373-21649395 TAGAAGAAGGAGAGATGATCTGG + Intergenic
927457143 2:23262795-23262817 CAGAAGAAGGAGCAACTCTCAGG + Intergenic
927823478 2:26289828-26289850 GAGAACAAGGAGAAAAGTACAGG - Intronic
928218155 2:29379701-29379723 CAAAAGAAGGAGTAATATTGAGG + Intronic
929343319 2:40849839-40849861 CAGAAGGGGGAGAAATGATATGG - Intergenic
929409320 2:41678823-41678845 CAAAGGAATGATAAATGTTCGGG + Intergenic
929446657 2:42007459-42007481 AAGAAGTGGGAGAAATTTTCAGG + Intergenic
929535157 2:42778040-42778062 TTGAAGAAGGAGGGATGTTCAGG + Intronic
930916697 2:56700007-56700029 CAAAAGAAGAAGAAAAGATCAGG - Intergenic
931171587 2:59809107-59809129 CAGAAGAAGAAGAATTGTTTTGG - Intergenic
932299216 2:70653935-70653957 AAGAAGCAGGAGAATGGTTCAGG - Intronic
932572473 2:72945309-72945331 CAGAAGAAAGAGATCTGGTCTGG - Intronic
932717119 2:74109174-74109196 CAGCTGAAGGAGGAATGTCCTGG - Intergenic
933333352 2:80922539-80922561 CCAAAGGAGGAGAAATGTGCAGG + Intergenic
933934544 2:87191463-87191485 CAGCAGAGGGAGAAAGGTTAAGG - Intergenic
935085592 2:99841547-99841569 CAGAACACTGAGAAATGTTCTGG + Intronic
935122124 2:100192248-100192270 CAGAAGAAGAATCAATGTGCTGG - Intergenic
936358599 2:111774433-111774455 CAGCAGAGGGAGAAAGGTTAAGG + Intronic
936694825 2:114933612-114933634 TAGAAGAAAGAGAAATGTGAAGG + Intronic
937253256 2:120537279-120537301 CAGAGACAGGAGAAATGTTGGGG + Intergenic
937380529 2:121372629-121372651 CAGAAGAATCAGAAGTCTTCTGG - Intronic
938710099 2:133968759-133968781 AAGAAGAAGGAGAAGTTTTGAGG - Intergenic
938726131 2:134110067-134110089 CAGAAGAAGGAGATAAATTGAGG + Intergenic
938732155 2:134155032-134155054 CAGAAGAGGGAGAACTCTCCTGG + Intronic
939202992 2:139062665-139062687 CTGAAGAAGGGGAAGTCTTCTGG - Intergenic
939354541 2:141084371-141084393 CAGAACAAGCAAAAATGTTAAGG + Intronic
939436577 2:142184705-142184727 TAGAAGTAGAAGCAATGTTCTGG + Intergenic
941225617 2:162843167-162843189 CAGAAGAGGCAGAAATTTTTAGG + Intergenic
941476354 2:165955588-165955610 CAGAAGAAGGAGATTTTCTCAGG - Intergenic
941756073 2:169187727-169187749 CAGAAGATGGGCAAATATTCAGG - Intronic
944148243 2:196529460-196529482 CAGATGAAGAAGTAAGGTTCAGG - Intronic
944382979 2:199132995-199133017 CACAAAAAAGAAAAATGTTCAGG - Intergenic
945275116 2:207980404-207980426 CAGAAGAAGAAAAAATGCACTGG + Intronic
945300729 2:208213898-208213920 GAGAAGTAGGGCAAATGTTCTGG + Intergenic
945959152 2:216114282-216114304 CAGAAGAAACAGAAGTGTCCAGG - Intronic
1169677651 20:8172704-8172726 AAGAACAAAGAAAAATGTTCAGG - Intronic
1170262811 20:14430263-14430285 CAGAAGGAGGTGACATGATCAGG + Intronic
1171843306 20:30241834-30241856 GAGAAGTCGGAGTAATGTTCTGG + Intergenic
1171964004 20:31515693-31515715 AAGCAGAAGGTGAAATGTGCTGG - Intronic
1172741628 20:37172947-37172969 GAGAAGAAGGAGAAAAATGCAGG - Intronic
1173577263 20:44120672-44120694 CAGAAGAAGAAGAATTGTCATGG + Intronic
1174319456 20:49729585-49729607 AAGAAGATGGAGAAATGATTGGG - Intergenic
1174685276 20:52448571-52448593 GAGAAGAAGGAGGAATGCTTAGG + Intergenic
1175200512 20:57273797-57273819 CAGAAGAAGGAGAAAAGGCAGGG - Intergenic
1177093741 21:16804421-16804443 CAGAAGAAGGAGCAAAATTATGG + Intergenic
1177589308 21:23142099-23142121 CTTAAGAAAGAGGAATGTTCAGG - Intergenic
1178799469 21:35779039-35779061 AAGGAGAGGGAGAAATGTACTGG + Intronic
1179578176 21:42320775-42320797 CAGAAGAAGAAGAATTGTCTTGG - Intergenic
1181340883 22:22178938-22178960 CAGGAGGAGGAGAGAAGTTCTGG - Intergenic
1182603298 22:31484328-31484350 TAGAAGAAGTATAAATGTTTTGG - Intronic
1182970363 22:34568087-34568109 CTAAAGAAGGAGATAGGTTCAGG + Intergenic
1183747661 22:39700861-39700883 CAGAGGAAGAAGAAATGGTTTGG + Intergenic
1183778819 22:39985410-39985432 CCGAAGAAGGAGAAAGGTGCAGG - Intergenic
1183861985 22:40677013-40677035 AAAAAGAAGAAGAAATATTCTGG - Intergenic
1184543639 22:45149537-45149559 CAAAGAAAGGAGTAATGTTCAGG - Intergenic
1185345920 22:50310642-50310664 CAGAAGAAAAAGAAAAGTCCCGG + Exonic
949693395 3:6666719-6666741 CAAAAGCAGGAGAAAGGTACAGG - Intergenic
950603083 3:14052714-14052736 CAGAAAAGGCAGAAGTGTTCAGG - Intronic
950650460 3:14403711-14403733 CAGAAGGAAGAGAAATAGTCTGG - Intronic
951025963 3:17830192-17830214 GACAAGAAGAAGAAATGGTCTGG - Intronic
951431892 3:22617645-22617667 TAGAAGCAGGAGAAAAATTCGGG - Intergenic
952558889 3:34566329-34566351 TTAAAGAAGGAGAACTGTTCTGG + Intergenic
952853617 3:37749672-37749694 CAGAAAATGGAGAAATGCTAGGG + Intronic
953435079 3:42871602-42871624 TAGAAGGAGGAGAAATGGGCTGG - Intronic
953827296 3:46264907-46264929 GAAAAGAAGCAGAAATGTTGTGG - Intronic
954052003 3:47987344-47987366 CAGAGGAAAGAGGAAAGTTCAGG + Intronic
954252277 3:49377195-49377217 CTGAAGCAGGAGGAATGCTCAGG + Intronic
955240216 3:57171111-57171133 CAGAGAGAGGAGAACTGTTCTGG + Intergenic
955609293 3:60739966-60739988 CAAAGAAAAGAGAAATGTTCAGG + Intronic
955645640 3:61134530-61134552 CAAAGGAAGGAGAAATGATCTGG + Intronic
955803800 3:62713222-62713244 CAGGAGAAGGAGAAATGGTCTGG - Intronic
955945784 3:64192188-64192210 CTGTAGAACCAGAAATGTTCAGG - Intronic
956647239 3:71468358-71468380 CACACCAAGGAGAAATGTTGGGG - Intronic
956842344 3:73152328-73152350 CAGAAGAATGAGAAATGAAATGG + Intergenic
956950025 3:74272121-74272143 TGGAAGAAGAAGAATTGTTCTGG + Intronic
957030307 3:75233064-75233086 CAGAAGATGGAGATAAGGTCAGG + Intergenic
957881292 3:86216518-86216540 GAGGAGAAGGGGAAATCTTCAGG + Intergenic
958145550 3:89619736-89619758 CTGAAGAAGGTGATATGTTCAGG - Intergenic
958830089 3:99076607-99076629 CAAAATAAGTAGATATGTTCTGG + Intergenic
959315895 3:104806114-104806136 CAGAAGAAAGAGAAATAATTTGG - Intergenic
959406284 3:105965665-105965687 CAGTAGATTGAGAAATTTTCAGG + Intergenic
959497100 3:107064382-107064404 GAGAATAAGGAGAAATGGTAAGG + Intergenic
960391380 3:117081459-117081481 TGGAGGAAGGAGAAATGGTCTGG - Intronic
960825994 3:121785146-121785168 CAGAAGGTGGATAACTGTTCTGG + Intronic
960928067 3:122816001-122816023 AAGCAGAAGGAGAAATATTTTGG - Intronic
963278103 3:143353052-143353074 CAGAAAATGGTGAAAAGTTCAGG - Intronic
964827051 3:160840081-160840103 CATTAGAAGAATAAATGTTCTGG - Intronic
965935034 3:174098222-174098244 CAATTGAAGGAAAAATGTTCGGG - Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967364833 3:188674265-188674287 CAGGAGAAGGAAAAATTGTCAGG - Intronic
967979111 3:195054804-195054826 CAGAAGAATGAGAAATGACTTGG - Intergenic
968336501 3:197918029-197918051 AAGAAGGAGGAGAAATGGGCTGG - Intronic
968451003 4:675987-676009 CAGAAGCTGGAGAAAAGATCAGG - Intronic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
969535413 4:7753732-7753754 CAGAAGAAGCAGACCTGTGCAGG + Intergenic
970508035 4:16752891-16752913 AAAAAGAAGGAGGAATGTTTAGG + Intronic
971626863 4:28932409-28932431 TAGAAGAAGAAGAATTATTCAGG - Intergenic
971734088 4:30423749-30423771 GAGAAGAAGGAGAAAAGTCTGGG + Intergenic
971862921 4:32131332-32131354 CAGAAGAAAGTGACCTGTTCTGG - Intergenic
972373968 4:38453015-38453037 CAGATTTGGGAGAAATGTTCAGG + Intergenic
972497090 4:39644171-39644193 CAGCATATGGAGAAATGTTATGG + Intergenic
972848190 4:43015141-43015163 CAGGAGAAGGAGAGAAATTCAGG + Intronic
974494591 4:62609963-62609985 GAGAAGAATGAGAAATGTTGAGG + Intergenic
974594223 4:63996000-63996022 GGGAACCAGGAGAAATGTTCAGG + Intergenic
975069005 4:70108944-70108966 CAGAAGAGGAAGAGAGGTTCAGG - Intergenic
975226957 4:71883826-71883848 CAAAAGAAAGAGAAAGGTACAGG - Intergenic
976163125 4:82225054-82225076 CAGATGAAGGAGCAGTGGTCTGG - Intergenic
977687557 4:99865698-99865720 AAGAAGAAAGAAACATGTTCAGG - Intronic
979106628 4:116697318-116697340 CTGAGGAAGTAGCAATGTTCAGG + Intergenic
980424419 4:132608182-132608204 CACAAGCAGGGAAAATGTTCTGG - Intergenic
980872855 4:138629871-138629893 AAGAAGGTGGAGGAATGTTCAGG - Intergenic
982187917 4:152820805-152820827 CAGTCGCAGGAGAAATGTGCTGG - Intronic
982446938 4:155502810-155502832 CAGTTGAATGAGAAATGTTTTGG + Intergenic
984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG + Intergenic
984426932 4:179599134-179599156 CAGAAGAAGGAGGAAAGTACCGG + Intergenic
984663590 4:182401049-182401071 GAGCAGAAGCAGGAATGTTCTGG - Intronic
984677162 4:182563018-182563040 CAGAATATGGAGAAAGGTACAGG + Intronic
985111671 4:186553467-186553489 CACAAGAAGTAAAATTGTTCAGG + Intronic
985443555 4:190004297-190004319 TAGGAGAAGGAGAAAAGTTAGGG + Intergenic
985886117 5:2680638-2680660 CAGCAGCAGGAGAGATGCTCCGG + Intergenic
987630806 5:20469486-20469508 TTGAAGAAAGAGAAATTTTCTGG - Intronic
988394671 5:30681233-30681255 TAGAACATGGAGAAATGTTACGG - Intergenic
988734980 5:34011459-34011481 CAAAACAATGATAAATGTTCTGG + Intronic
988774004 5:34460143-34460165 TTTAAGAAAGAGAAATGTTCAGG - Intergenic
989020885 5:37006367-37006389 CTGAAGAAGAAGAAAGGTTATGG + Exonic
989585059 5:43068012-43068034 TAGAAAAACGAGAAAGGTTCTGG - Intronic
989963076 5:50439277-50439299 CAGAAGGGGGAAAAATGTCCTGG + Intronic
990945592 5:61245857-61245879 CAGAAGACTGAGAAATTCTCTGG + Intergenic
991037873 5:62145941-62145963 CAAAATAAGGAGAAATTTTTTGG + Intergenic
991244920 5:64500289-64500311 CAAAAGCAGGACAAATGATCTGG - Intergenic
991308288 5:65205863-65205885 CAGAGGAAGGAAACATATTCAGG + Intronic
991380222 5:66014276-66014298 AAGAAGGAGGAGAAATCCTCTGG - Intronic
992263397 5:74992923-74992945 GAGAAGAGGGAGCAATATTCGGG + Intergenic
992916893 5:81464067-81464089 CAGAAGAAAGAGGATTTTTCAGG - Intronic
994260794 5:97656264-97656286 CAGAGGAAGGAGGAATATTGTGG + Intergenic
995762895 5:115582713-115582735 AAGAACAAGTAGAAATGCTCTGG - Intronic
996074173 5:119169866-119169888 CAGACTGAGGAGAAGTGTTCAGG + Intronic
997108027 5:131044173-131044195 AAGAAGAAGAAGAAAACTTCAGG + Intergenic
997223211 5:132187929-132187951 CTGAAGAAGGATAAATCTTGTGG + Intergenic
997905664 5:137814490-137814512 CAGAAGAAGAAGAATACTTCCGG + Intergenic
998429436 5:142058114-142058136 GAGCAGAAGGGGAAATCTTCTGG - Intergenic
998492652 5:142560429-142560451 CTTAAGGAGGAGAACTGTTCAGG - Intergenic
998805418 5:145913580-145913602 CAGAAAAAGGAGAAAATTTCCGG - Intergenic
999843654 5:155455140-155455162 TAGAAGAAAAAGAAATGTTCAGG - Intergenic
1001169832 5:169408681-169408703 CAGGAGACAGAGAGATGTTCAGG + Intergenic
1002089276 5:176794890-176794912 CACAGGAAGGAGATATTTTCAGG - Intergenic
1003091987 6:3112087-3112109 CAGTAGAAGGAGAGAGGTTATGG + Intronic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003380263 6:5618644-5618666 CTGAAGGAGGATAGATGTTCAGG + Intronic
1003491405 6:6625739-6625761 CAGCAGCTGGAGAAATGTTATGG + Intronic
1004747608 6:18526890-18526912 CAGATGAAGGATAAATGGACAGG + Intergenic
1005161094 6:22864664-22864686 GAGAAGGATGAGAAAAGTTCAGG + Intergenic
1005413460 6:25575737-25575759 GTGAAGAATGAGAAATTTTCAGG + Intronic
1005979187 6:30823371-30823393 AAGAAGAAGAAGAAATGGGCTGG - Intergenic
1006175782 6:32120745-32120767 CTGAAGAAGGAGAAAAGGGCCGG - Intronic
1007145278 6:39623499-39623521 CAAAAGAAGGTAAAATGCTCAGG - Intronic
1007191228 6:40020642-40020664 GAGAAGATGGAAAAATGTTAGGG - Intergenic
1009025829 6:57999200-57999222 TAGAAAAAGGAGCTATGTTCAGG + Intergenic
1009201387 6:60750669-60750691 TAGAAAAAGGAGCTATGTTCAGG + Intergenic
1012184934 6:96201461-96201483 AATAAGAAGGAAAAATGTTAAGG - Intronic
1013259417 6:108426267-108426289 CAGAAGAAGAAAAAATCTTGTGG + Intronic
1013816509 6:114104728-114104750 CAGAAGAAGGAGAATACTTTTGG + Intronic
1016908048 6:149170811-149170833 CAGGAGAAGGAGAAATTATGTGG - Intergenic
1018055521 6:160049003-160049025 CAGGAGACGGGTAAATGTTCTGG - Intronic
1020362754 7:7347342-7347364 AAGAAGAAAGAGCTATGTTCTGG - Intergenic
1020950462 7:14669546-14669568 CAGAGAAAGAAGAAATGTTGGGG - Intronic
1021856896 7:24865970-24865992 CCGAAGAAGGAAAAGTTTTCGGG - Intronic
1022053460 7:26703169-26703191 CAGAAGAAGAAGAATTGTCTTGG + Intronic
1022055469 7:26728808-26728830 CAGAAGAAAGAGAAATTTCAGGG + Intronic
1022542578 7:31152520-31152542 CATACAAAGGTGAAATGTTCTGG - Intergenic
1022946812 7:35293852-35293874 CAGGAGAAGGGGAAAGGTTTAGG - Intergenic
1023379103 7:39588213-39588235 TAGAAGAAGGAAAAATGGGCCGG + Intronic
1023654496 7:42406401-42406423 CAGAAGATGGAGAAATGCAGAGG - Intergenic
1023658201 7:42447397-42447419 CAGAAGGAGGAGAAAGATCCTGG - Intergenic
1024172724 7:46807072-46807094 GAGAACAAGAATAAATGTTCTGG - Intergenic
1024194255 7:47043291-47043313 CAGAACTAGGAGAATTGCTCAGG - Intergenic
1025039405 7:55627228-55627250 TTTAAGAAGGAGGAATGTTCAGG - Intergenic
1025966825 7:66280925-66280947 CAGAACATGCTGAAATGTTCTGG - Intronic
1026205586 7:68254862-68254884 CAGAAGAAGGAGAAAAGAAGAGG - Intergenic
1026553637 7:71388182-71388204 CAGAGGAAGGATAAAAGCTCAGG - Intronic
1026628979 7:72021333-72021355 AAGAAGAAGGAGAAACGCCCAGG + Intronic
1028486680 7:91366269-91366291 CAGAATAAGGATAAACTTTCTGG - Intergenic
1030107695 7:106000382-106000404 CAGAGGAAGGAGAAATGGCAGGG - Intronic
1030452730 7:109732769-109732791 CAGAAGGAGGAAAAATGCACTGG + Intergenic
1030512952 7:110507258-110507280 AAAAAGAATAAGAAATGTTCCGG - Intergenic
1032504090 7:132422863-132422885 CAGAAGATGGACAAACGTGCTGG + Intronic
1033001277 7:137507992-137508014 AAGAAGAAAAGGAAATGTTCAGG + Intronic
1034279396 7:149842076-149842098 CAGGAGAAGGATAAATGCTTGGG + Intronic
1037234410 8:16700994-16701016 GAGAAGTAGGAGAAATGTAAAGG - Intergenic
1038207581 8:25481905-25481927 CAGATGAAGGAGATTTGTTTGGG + Intronic
1042030366 8:64469560-64469582 CAGAGGAAGGAGAAAGGTAGAGG - Intergenic
1042424267 8:68628359-68628381 AAGACGAAGGAAAGATGTTCAGG - Intronic
1042657182 8:71112573-71112595 CAGACGACAGACAAATGTTCAGG - Intergenic
1043030317 8:75126385-75126407 CAAGAGAAAGAGAAATGTTTGGG - Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1045326589 8:101121949-101121971 AATAAGAAGGAGAAATGAGCTGG - Intergenic
1045616302 8:103916746-103916768 CAAAAGAAGAAGAAATATTTAGG + Intronic
1048077970 8:131094104-131094126 GAGAAGAAGGATAATAGTTCTGG + Intergenic
1048516562 8:135116765-135116787 GAGAAGAAGGAGAAAGGAGCCGG - Intergenic
1049234493 8:141505675-141505697 GAGGAGAAGGAGACATGCTCTGG - Intergenic
1050050715 9:1598298-1598320 CCGCAGAAGGAGAGGTGTTCTGG - Intergenic
1050443566 9:5693099-5693121 TGGAAAAAGGAGAAATGATCTGG + Intronic
1051095988 9:13465631-13465653 CAGAAGAAGGAGAAGAGTAATGG + Intergenic
1051543092 9:18243298-18243320 GAGAAGAAGGAGTAATATTTTGG - Intergenic
1052384031 9:27804285-27804307 CACAAGAATGAGAGCTGTTCAGG + Intergenic
1052552262 9:29967266-29967288 CAGAAGAGGGAGAAGGGTTTTGG - Intergenic
1052882611 9:33613040-33613062 TAGAAGAAGGAAAATTGTTTTGG + Intergenic
1052900898 9:33794221-33794243 TAAAAGAAGCAGAGATGTTCTGG - Intronic
1053242464 9:36507224-36507246 AAGAAGAAGAAGAAATGCCCTGG - Intergenic
1056972143 9:91214541-91214563 CATAATTAGGAGAATTGTTCAGG - Intronic
1057165397 9:92921397-92921419 CATAAGAAGGAGTATTTTTCGGG + Intergenic
1057517490 9:95734429-95734451 CAGAAGAAAAAAAAATGTCCAGG + Intergenic
1057528839 9:95826410-95826432 TAGAACAAGAAGAAATATTCTGG - Intergenic
1057919406 9:99084575-99084597 CTTAAAAAGGAGAAATGGTCCGG + Intergenic
1058733595 9:107874076-107874098 CCGAAGAAACAGAAATGTTTTGG + Intergenic
1059455396 9:114397401-114397423 CAGAAGGAGAAGAAATGGGCTGG - Intergenic
1059865925 9:118513889-118513911 CTGAAGCAGGAGAATTGTTAAGG + Intergenic
1061676121 9:132216756-132216778 CAGAAGAAGGGGAAATATCTGGG + Intronic
1061739950 9:132695155-132695177 CAGAAAAAGGAGGAATGTAAGGG + Intergenic
1061886673 9:133594521-133594543 CAGAAGAGGGAGCCATCTTCAGG - Intergenic
1186176551 X:6931103-6931125 CCCAAGAAAGAGAAAGGTTCTGG + Intergenic
1187863918 X:23706751-23706773 GAGAATAAGGAGCAATGATCAGG + Intronic
1188042141 X:25381007-25381029 CTGAAAAGGGAGCAATGTTCAGG + Intergenic
1188472000 X:30551606-30551628 CAGAAGAAGAAGAATTGTCTTGG - Intergenic
1188984293 X:36755596-36755618 CAGACTAAGGAGAAAAGTTGTGG - Intergenic
1189897336 X:45669112-45669134 AAGAAGAAGGAATGATGTTCTGG + Intergenic
1190369531 X:49727467-49727489 CAGAAGACAGAGAAATGATGGGG + Intergenic
1194701655 X:97120681-97120703 TAGAAGAAGGAGAATTGTCTTGG - Intronic
1195751133 X:108162856-108162878 CAGAAAAAGGAGATTTGTTGGGG - Intronic
1197247641 X:124182464-124182486 CAGGAGAAAGTGAAATGTTGTGG - Intronic
1197322751 X:125052774-125052796 TAAGAGAAGGACAAATGTTCCGG + Intergenic
1198026041 X:132708217-132708239 CAGAAGGGGGATGAATGTTCAGG - Intronic
1200916491 Y:8575778-8575800 GAGAAGAAGCAGACATGTGCTGG - Intergenic
1201453393 Y:14141345-14141367 TAGAAGAATCAGAAAAGTTCTGG + Intergenic