ID: 1119756403

View in Genome Browser
Species Human (GRCh38)
Location 14:77123070-77123092
Sequence TGCAAATGGCTGACCAGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119756403_1119756409 18 Left 1119756403 14:77123070-77123092 CCGTGCCTGGTCAGCCATTTGCA 0: 1
1: 0
2: 2
3: 27
4: 280
Right 1119756409 14:77123111-77123133 GATGAAGAACACAACTTTTAGGG 0: 1
1: 0
2: 2
3: 16
4: 250
1119756403_1119756408 17 Left 1119756403 14:77123070-77123092 CCGTGCCTGGTCAGCCATTTGCA 0: 1
1: 0
2: 2
3: 27
4: 280
Right 1119756408 14:77123110-77123132 AGATGAAGAACACAACTTTTAGG 0: 1
1: 0
2: 1
3: 29
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119756403 Original CRISPR TGCAAATGGCTGACCAGGCA CGG (reversed) Intronic
900631357 1:3637549-3637571 TGAAAATGTGTGGCCAGGCATGG + Intronic
900793777 1:4695400-4695422 GGCCAACGGCTGGCCAGGCAAGG + Intronic
903047927 1:20578279-20578301 GGGAAAGGGCTGACGAGGCAGGG - Intergenic
903089017 1:20892704-20892726 TGCAAAGTGCAGAGCAGGCATGG - Intronic
903457072 1:23494986-23495008 TGCAGATGACTGGCCAGGCATGG - Intergenic
903504473 1:23823641-23823663 TGTAAATGGCTCACCAGGCGTGG - Intronic
903684378 1:25120182-25120204 GGCAATGGGCTGGCCAGGCAGGG - Intergenic
904483001 1:30805748-30805770 TGCTCAGGGCTGACCAGGCAGGG + Intergenic
904637222 1:31891524-31891546 TGGAAATGACTGACTAGACACGG + Intergenic
905669598 1:39782757-39782779 AGCAAGTGTCTGGCCAGGCACGG - Intronic
905730626 1:40296890-40296912 TTAAAATTGCTGGCCAGGCACGG - Intergenic
906734053 1:48107420-48107442 TGCACAGGGGTGGCCAGGCATGG - Intergenic
907468806 1:54657949-54657971 TAAAAATGGCTGGCCAGTCATGG - Intronic
909563452 1:77029589-77029611 TGGAAGTGGCTGCCCAGTCAGGG - Intronic
910106336 1:83634904-83634926 TGCACATGGCTGAAAAAGCACGG - Intergenic
911979507 1:104549191-104549213 TGTAAATGGCTGACTAGACATGG + Intergenic
912751087 1:112288326-112288348 AGCAAATGGCACACCAGGCTTGG + Intergenic
913252856 1:116926347-116926369 TGAAAATGGCTGAGCAGGGAGGG + Intronic
918180612 1:182083620-182083642 TGCAGATGACAGACCAGGCCTGG - Intergenic
918193571 1:182199955-182199977 TGCAAATAGGTGGCCAGACATGG + Intergenic
918849346 1:189665425-189665447 TGAAAAGAGCTGGCCAGGCACGG - Intergenic
922391379 1:225146784-225146806 GGGAAATGGCTGTCCAGGGAGGG + Intronic
922650501 1:227334176-227334198 TGCAGCTGGGTGACCGGGCACGG + Intergenic
922822545 1:228494183-228494205 GGCAGATGGGTGACCAGGGAAGG - Exonic
922911937 1:229225601-229225623 GGCAAACTGCTCACCAGGCAGGG + Intergenic
1063223380 10:3992121-3992143 TGCATCTGGCTGCTCAGGCAGGG + Intergenic
1064141603 10:12795390-12795412 TGGGAATGGGAGACCAGGCACGG - Intronic
1066585774 10:36933325-36933347 TGCAAATGGCTCTCCTGGGATGG - Intergenic
1070576277 10:77681430-77681452 TGCAAAGGGCAGACCACCCAAGG - Intergenic
1071415050 10:85433437-85433459 TGGCAATGGCTGGCCAGGAAAGG + Intergenic
1072057454 10:91774244-91774266 TGCACATGGCTGAGGAGTCAAGG - Intergenic
1072438808 10:95436376-95436398 TGCAGAGGGGCGACCAGGCAGGG + Intronic
1072794200 10:98341926-98341948 TGCAGGTGGCTGGCCAGGCGCGG - Intergenic
1073316677 10:102586173-102586195 TACAAATAGCTGGCCGGGCATGG - Intronic
1074083033 10:110182787-110182809 TGCCAATTGCTGGCCAGGCATGG + Intergenic
1074882416 10:117669271-117669293 TGCAAATGTCTGGCCCGGCCTGG + Intergenic
1075700699 10:124467862-124467884 TACAAATGATTAACCAGGCATGG - Intronic
1076176449 10:128371994-128372016 TGCAGATGCTTGGCCAGGCATGG - Intergenic
1076642581 10:131928822-131928844 TCCAAATGGCCGTCCAGGCAGGG + Intronic
1078461902 11:11520772-11520794 AGGAAATGCCTGACCAGGAAGGG - Intronic
1079494756 11:21029562-21029584 TGCAAATGCCTGACCTGCTAGGG + Intronic
1081292942 11:41349118-41349140 TGAGAATGTGTGACCAGGCAGGG - Intronic
1083466207 11:62848031-62848053 TGCAAATACCTGGCCAGGCATGG - Intergenic
1084175070 11:67418719-67418741 GGCAAGTGGCTGGCCAGGGAAGG - Intronic
1084183472 11:67457966-67457988 TGGAACTGGCTGGCCAGGCGCGG + Intronic
1085292029 11:75407755-75407777 TGCAGATGTTTGGCCAGGCACGG - Intronic
1085416369 11:76321519-76321541 AGCAAATGACTGGCCAGTCAGGG + Intergenic
1085588820 11:77737837-77737859 AGCGAATAGCTGGCCAGGCACGG + Intronic
1086067319 11:82759969-82759991 TGCAAATGTAGGAGCAGGCATGG - Intergenic
1086823587 11:91467514-91467536 TGCAAATAGCTAGCCGGGCATGG - Intergenic
1086918762 11:92561914-92561936 TCCAAATGGTAGGCCAGGCATGG - Intronic
1088177818 11:107073975-107073997 TGCAAAGGTTTGAGCAGGCATGG + Intergenic
1089465376 11:118681675-118681697 TAAAAATTGTTGACCAGGCATGG - Intergenic
1091187499 11:133659340-133659362 TGCAAAGGGCTGAGCAGGACTGG - Intergenic
1091604032 12:1935367-1935389 TGCAAATGGGAGGCCAGGGAAGG - Intergenic
1092697011 12:11183463-11183485 TGCAGATTACTGGCCAGGCACGG + Intergenic
1093029108 12:14271892-14271914 TGCATATGGGGGGCCAGGCATGG - Intergenic
1093771516 12:23023253-23023275 TGCGAATGGCAGGCCAGGCGTGG - Intergenic
1094176487 12:27546857-27546879 TGCAAAAAACTGGCCAGGCATGG + Intronic
1095445233 12:42275973-42275995 TGCAACTGGCTGAGGAGGCAGGG + Intronic
1096097350 12:48944857-48944879 TCTAAATAGCTGGCCAGGCATGG + Intronic
1097004337 12:55904301-55904323 AGCAAAAAGCTGGCCAGGCACGG + Intronic
1098875114 12:75858906-75858928 TGGTGCTGGCTGACCAGGCAAGG + Intergenic
1099526015 12:83720387-83720409 TGCAAGTGGCTGACCTGCAATGG + Intergenic
1100270460 12:93019749-93019771 TGCAAATGACTGGCAAGGCGTGG - Intergenic
1100924306 12:99526649-99526671 TTGAAGTGGCTGACCAAGCAAGG - Intronic
1101541242 12:105667362-105667384 TGCAAATGAATTAGCAGGCATGG - Intergenic
1101891991 12:108725440-108725462 TGCAAAAGGCTTACCTTGCAGGG - Intronic
1101968594 12:109296931-109296953 TGCAAGAGCCTGATCAGGCAGGG + Intronic
1102361057 12:112288036-112288058 AGCAAGTTGCTGGCCAGGCACGG + Intronic
1102362836 12:112303200-112303222 TGCAAATGTGTGAACAGGAAGGG + Intronic
1102571920 12:113831946-113831968 TGCACATGGCTGGCCATGCAGGG - Intronic
1103876586 12:124132209-124132231 AGAAAAAAGCTGACCAGGCATGG + Intronic
1104070146 12:125337570-125337592 TGCATATGGCTGCTCAGGCAGGG - Intronic
1108489696 13:50969198-50969220 TGGAAAAAGCTGACCAGGCAGGG + Intronic
1108579277 13:51815018-51815040 TGGGAATGGCTGACGAGTCATGG + Intergenic
1108590163 13:51906094-51906116 AGCAAATGGTGGACCAGGCTGGG + Intergenic
1109219008 13:59622330-59622352 TCAAAATGACTGGCCAGGCATGG + Intergenic
1111939714 13:94596353-94596375 TGCACCTGGCGGACCAGGCAAGG - Intergenic
1112374860 13:98829793-98829815 TTCAAATGACTGCCCAGGCTGGG + Intronic
1112503723 13:99960944-99960966 TGCAAGTGCCTAATCAGGCAGGG - Intergenic
1115785273 14:36818457-36818479 TGCAAAAGGATGGGCAGGCATGG + Intronic
1116859666 14:49983718-49983740 TAAAAATGGCTGGTCAGGCACGG - Intronic
1116879671 14:50152662-50152684 TGAAAAATGCTGGCCAGGCATGG + Intronic
1118649752 14:67877953-67877975 TACAAATTTCTGGCCAGGCATGG - Intronic
1118716250 14:68562198-68562220 TGCAAATGTCTGGTGAGGCAGGG - Intronic
1119755862 14:77119009-77119031 TGCAGATGGCTGACCAGAAAAGG - Intronic
1119756403 14:77123070-77123092 TGCAAATGGCTGACCAGGCACGG - Intronic
1121195722 14:92069660-92069682 TGCTTATAGCTGACCAGGCATGG - Intronic
1122500024 14:102191283-102191305 GGCAGATGGCTTCCCAGGCAGGG - Intronic
1123629599 15:22252654-22252676 TGCAGATTCCTGGCCAGGCACGG + Intergenic
1124024820 15:25955807-25955829 TGCAAATGTCTGGCAAGACAAGG - Intergenic
1124045899 15:26149491-26149513 TGCCACTGGCTGAGCAGCCAGGG + Intergenic
1124256370 15:28145987-28146009 TGCAACTGTCTGATGAGGCAGGG + Intronic
1126422151 15:48486103-48486125 TGCAAATGGCACATCATGCATGG - Intronic
1127879753 15:63146448-63146470 TCCAAATGGGGGCCCAGGCATGG - Intronic
1128427435 15:67556074-67556096 TACAAATAGCTGGCCAGGTACGG - Intronic
1128886044 15:71289231-71289253 TGCACATGGCTGAGCATCCATGG - Intronic
1130337937 15:82973773-82973795 AGCCAATGTCTGGCCAGGCATGG + Intronic
1130567466 15:85008781-85008803 TGCAGATGGCTCAGCAGACAGGG - Intronic
1130603971 15:85298279-85298301 GGGATATGGCTGGCCAGGCATGG - Intergenic
1130941679 15:88515247-88515269 TAAAAATGACTGGCCAGGCACGG + Intronic
1131408874 15:92189291-92189313 TTCAAATGCCTTACCCGGCAAGG + Intergenic
1132780828 16:1624293-1624315 TGCGTGTGGCTGCCCAGGCAGGG + Intronic
1133711834 16:8409041-8409063 TGCAAACTGCTGACAAGGAATGG - Intergenic
1135805604 16:25539744-25539766 TGCAAGGTGCTGGCCAGGCACGG + Intergenic
1136379493 16:29886070-29886092 AGCAGATGCTTGACCAGGCATGG + Intronic
1137030942 16:35523610-35523632 TGCATACAGCTGACCAGGCATGG + Intergenic
1137403245 16:48170493-48170515 TTCAATTGGGTGGCCAGGCAAGG - Intronic
1138485144 16:57336371-57336393 TACAAATGGCCGGCCAGGCATGG - Intergenic
1139552308 16:67681134-67681156 CACATATGGCTGACCAGGGAGGG + Intronic
1141766419 16:86062674-86062696 TGCCGCAGGCTGACCAGGCAGGG + Intergenic
1141973544 16:87498106-87498128 TGCAAATTCCTGGCCAGGCACGG - Intergenic
1143315621 17:6030593-6030615 TGAAAATGGCTGGCCGGGCGCGG - Intronic
1143550708 17:7628734-7628756 TGCAAATGACAGACCGGGCTTGG - Intronic
1145740843 17:27273119-27273141 TTAAAATGGCTCTCCAGGCATGG + Intergenic
1146723365 17:35138732-35138754 TGCAGATTGCTGGCCAGGCGTGG - Intronic
1146839880 17:36143886-36143908 TGGCAATGGCTAACTAGGCATGG + Intergenic
1147279760 17:39349378-39349400 TGGAAAATTCTGACCAGGCATGG - Intronic
1148357267 17:46983855-46983877 TGTAAAAGCCTGACCAGGGAGGG + Intronic
1148500793 17:48089389-48089411 TGCAGATGCCTGGCCAGGCGCGG - Intronic
1149041802 17:52198760-52198782 TGCACATGGTTGACAAGGAAAGG + Intergenic
1149721879 17:58852890-58852912 TACAAATGGTAGACCAGGCGTGG - Intronic
1150680076 17:67277588-67277610 TGAAAATGACTGAGCAGACAAGG + Intergenic
1150716414 17:67576165-67576187 TGCAAATACTTGGCCAGGCACGG - Intronic
1152259223 17:79257869-79257891 AGCAAAGGACAGACCAGGCATGG - Intronic
1153201510 18:2652495-2652517 AGAAAATAGCTGGCCAGGCAGGG + Intergenic
1153868355 18:9293868-9293890 TGCAAAAACCTGGCCAGGCACGG - Intergenic
1157304654 18:46508139-46508161 TGCTAATGGCTGAACAGGGGAGG + Intronic
1157845572 18:51001000-51001022 TGCAAGTGGCTGACCTGCAATGG + Intronic
1158441190 18:57475633-57475655 TGCATATGTCAGCCCAGGCATGG + Intronic
1160234196 18:77072908-77072930 TGACAATGGCTGAACAGGCCAGG - Intronic
1161190748 19:2953912-2953934 TGCAAAAGCCTGGCCAGGCGCGG + Intergenic
1162406424 19:10477130-10477152 TGCAACTGCTTGGCCAGGCACGG + Intergenic
1162508372 19:11101793-11101815 TTAAAATGGGAGACCAGGCATGG + Intronic
1162920833 19:13901745-13901767 AGAAAAAGTCTGACCAGGCATGG + Intronic
1165139716 19:33691292-33691314 TGCAGCTGGCAGACCTGGCAAGG + Intronic
1166693062 19:44835727-44835749 TGCCAGGGGCTGGCCAGGCATGG - Intergenic
1167699753 19:51035464-51035486 TCCAAATAGGTGATCAGGCAGGG + Intergenic
927811153 2:26180905-26180927 TGGAGATGGCAGGCCAGGCACGG - Intronic
928079219 2:28294088-28294110 AGCAAATGGCTGGCCAGGCATGG + Intronic
928690563 2:33794340-33794362 TTCAGGTGGCTGGCCAGGCATGG + Intergenic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
932603269 2:73144959-73144981 TGTAATAGGCTGGCCAGGCACGG - Intronic
933581660 2:84133704-84133726 TAAAACTAGCTGACCAGGCACGG - Intergenic
933824734 2:86149040-86149062 TACATATGACTGAGCAGGCAAGG + Intronic
934516821 2:94993627-94993649 TGCACATGGCTGGCAAGGGAGGG + Intergenic
935256665 2:101315595-101315617 TGTAAAGGGCTGCCCAGGCCTGG - Intergenic
935711629 2:105903986-105904008 TGCAAATATCCGGCCAGGCACGG + Intergenic
936471645 2:112804020-112804042 TGTAAATGACTGACCATTCAAGG + Intergenic
937994658 2:127684029-127684051 TGCACAGGGCTGACCAGCTACGG + Intergenic
937997697 2:127707692-127707714 ATCAAATGGCAGGCCAGGCATGG + Intronic
943494932 2:188608439-188608461 TGCTAATGGCTGTCATGGCAGGG - Intergenic
944460332 2:199942355-199942377 TGCAAAAGGCTGGCCGGGCGCGG - Intronic
944662425 2:201932337-201932359 AGCCACTGGCTGCCCAGGCAAGG - Intergenic
945253062 2:207780530-207780552 TGCAAGAGGCAGGCCAGGCATGG + Intergenic
945584517 2:211642391-211642413 TGAAAAGGACTGACCAGACAGGG - Intronic
946618977 2:221540667-221540689 TGCAACTGGATAACCAGCCAGGG + Intronic
946865262 2:224036714-224036736 TGCAAAGAGCTGAACAGGAAGGG + Intronic
1168861206 20:1047239-1047261 CACAAGTGGCTGTCCAGGCAGGG + Intergenic
1169251454 20:4064286-4064308 TGCAATTGGAGGACTAGGCAGGG - Intergenic
1169364738 20:4982813-4982835 TCCAAATGTGTGGCCAGGCACGG + Intronic
1169899154 20:10535211-10535233 TGCAAATGGCTGCTGAGGAAGGG + Intronic
1170831975 20:19850667-19850689 TAGAAATGGCAGACCAGGCTGGG + Intergenic
1171981997 20:31634899-31634921 TTCTAAAGGCTGGCCAGGCATGG - Intergenic
1173598852 20:44278669-44278691 TGCAAATACGTGGCCAGGCATGG - Intronic
1173629266 20:44498282-44498304 TTCTAATTGCTGGCCAGGCACGG + Exonic
1173629877 20:44504810-44504832 TGGACATGGCTGACCAGGTGAGG + Exonic
1174157405 20:48524741-48524763 TGCAAAGGGCTGGCCAGGGGTGG + Intergenic
1178462503 21:32815736-32815758 TCCAAATGGCTGAATAGGCCTGG - Intergenic
1179119491 21:38529672-38529694 TACACATGGCTGGCCAGGCGCGG + Intronic
1179139397 21:38710901-38710923 TATAAATAGCTGGCCAGGCACGG - Intergenic
1179287957 21:39994483-39994505 TTCCCAGGGCTGACCAGGCAAGG - Intergenic
1179403071 21:41102364-41102386 TGAGAATGTCTGACCAAGCAGGG + Intergenic
1180028227 21:45181124-45181146 TGCATCTGGCTGTCCAGGCTGGG - Intronic
1182302259 22:29343546-29343568 TCCCATTGGCTGCCCAGGCAGGG - Intronic
1183261918 22:36800658-36800680 AGCCAATGCCTGACCAGGCCTGG + Intergenic
1184742198 22:46435240-46435262 TGGACAAGGCTGGCCAGGCAAGG - Intronic
949265707 3:2154092-2154114 TGGATATGACTGGCCAGGCATGG + Intronic
949554791 3:5143597-5143619 TGCAAACGGCTGAACAGGGGTGG - Intronic
952793474 3:37218429-37218451 TGCCAATGGCAAGCCAGGCATGG - Intergenic
953566007 3:44032655-44032677 TGACAAAGGCTGAACAGGCAAGG - Intergenic
953754604 3:45635605-45635627 TGGAATTGTCTGGCCAGGCATGG + Intronic
957636482 3:82791514-82791536 TGCAAAGGGCGAGCCAGGCACGG - Intergenic
958806789 3:98821032-98821054 GGCAAATGACTGCCCATGCATGG + Intronic
959186012 3:103049156-103049178 GGCATATGGTGGACCAGGCAAGG - Intergenic
959340148 3:105118524-105118546 TGGGAAGGGCTGGCCAGGCACGG - Intergenic
961239580 3:125398778-125398800 TGCCTAAGGCTGACCAAGCATGG - Intergenic
961620992 3:128224989-128225011 TACACCTGGCTGCCCAGGCATGG + Intronic
961807064 3:129496983-129497005 AGAAAATGCCTGACCAGGCTGGG + Intronic
962119317 3:132545098-132545120 TAAAAATAGCTGGCCAGGCACGG + Intergenic
963797659 3:149647374-149647396 GGCCACTGGCTGCCCAGGCAGGG + Intronic
964014762 3:151931093-151931115 TGCCAGTGCCAGACCAGGCATGG - Intergenic
964763838 3:160159245-160159267 TGCAAATGGGACACCAGGCTGGG - Intergenic
965125414 3:164621331-164621353 TACAAATGACTAACCAGGCCTGG - Intergenic
966981066 3:185136295-185136317 TACAAATATCTGGCCAGGCATGG + Intronic
968848366 4:3060752-3060774 TGCACATGGTTGACAAGGAAAGG - Intergenic
969082246 4:4627796-4627818 TTCAAAGGCCTGACAAGGCAAGG - Intergenic
970442071 4:16089681-16089703 TGCAAAAGGCTGCCCAGACTAGG - Intergenic
970529799 4:16969964-16969986 TGCAAATAACTGACAGGGCAAGG - Intergenic
970927700 4:21472124-21472146 TGGGAATGGCTGCCCAGTCAGGG + Intronic
971969196 4:33599975-33599997 TGCACATGGATGACAAGGAAAGG - Intergenic
973205695 4:47557971-47557993 GGCCAATGGCTGTCCAGGGAGGG - Exonic
973588258 4:52413754-52413776 AGCAAGTGGCTGCCCAGGCAGGG + Intergenic
974057642 4:57000272-57000294 TGCAAAAGGTTAACCAGGCATGG + Intronic
974698044 4:65399355-65399377 TGCAAAGGGCAAGCCAGGCATGG - Intronic
982014553 4:151140416-151140438 TACAAAATGCAGACCAGGCATGG - Intronic
982391236 4:154865970-154865992 TGCACATGGCTGCCCAGTTAGGG - Intergenic
983556925 4:169067565-169067587 TACAAATTGCTGCCCAGGCATGG + Intergenic
985589648 5:757890-757912 TGCAAGTGTCTGACCAGTCCTGG - Intronic
986268546 5:6211416-6211438 TGCACATGGTTGACAAGGAAAGG + Intergenic
987608879 5:20176072-20176094 TGCAGATGGCTGACTAGGTGGGG - Intronic
988466688 5:31498565-31498587 GGGAAAAGGCTGGCCAGGCACGG + Intronic
992267454 5:75033192-75033214 TGGAAATGAGTGACAAGGCAGGG - Intergenic
992953372 5:81883093-81883115 TGCAAGGTGCTGACTAGGCAAGG + Intergenic
993832410 5:92776548-92776570 TGAAAAAGGCTGTCCAGGTATGG - Intergenic
994579694 5:101625216-101625238 TTCATATTTCTGACCAGGCATGG + Intergenic
994958092 5:106561538-106561560 TGCAAGTGGCTGCCCTGCCATGG + Intergenic
997528580 5:134568764-134568786 TGCAAATGTGTGACCTGGAAAGG - Intronic
998500292 5:142626768-142626790 GGCAAATGGCTGCCCTGACAAGG - Intronic
999163738 5:149529590-149529612 AGAAAAGGGCTTACCAGGCAGGG + Intronic
999331149 5:150674214-150674236 TTCAAATGACTGGGCAGGCAGGG - Intronic
999367044 5:151029982-151030004 TGCAAATAGCTATCCAGGGATGG + Exonic
999453613 5:151696871-151696893 GGCAGATGGCTGACGAGGAAGGG + Intergenic
999837108 5:155386020-155386042 TGACAATGGCAGAGCAGGCAGGG + Intergenic
1000109371 5:158093345-158093367 GGCAAAAGTCTGATCAGGCAGGG - Intergenic
1000322499 5:160145969-160145991 AGCTAATGCCTGACCAGGCAGGG + Intergenic
1000713456 5:164609002-164609024 GGAAAATGGCAGGCCAGGCATGG - Intergenic
1001257186 5:170193040-170193062 TGCAGATGGCTCTCCAGGCCAGG - Intergenic
1001424937 5:171616782-171616804 TGCAGATGGGTGATCTGGCAGGG + Intergenic
1001597437 5:172907152-172907174 TGCAAGAGGGAGACCAGGCAGGG - Intronic
1002663110 5:180804103-180804125 TGCTAAGGGGTCACCAGGCATGG + Intronic
1005484716 6:26288956-26288978 CGCATATGGCCAACCAGGCACGG - Intergenic
1005849238 6:29807013-29807035 TTGAAATGGCTGACCAGGCACGG - Intergenic
1006030831 6:31175500-31175522 GGAAAAGGGCTGACCAAGCACGG + Intronic
1006147045 6:31965904-31965926 TGCAGATGGCAGGCCGGGCAGGG + Exonic
1006228405 6:32560610-32560632 TGCCTATGGCTGACCAAGCGTGG - Intronic
1006469129 6:34216506-34216528 ATCAATTGGCTGGCCAGGCACGG + Intergenic
1007619893 6:43205538-43205560 TGGAGATGGCTGGCCAGGCGCGG + Intronic
1008609896 6:53176099-53176121 TGCAAAAGGCTAACCAGGGCCGG - Intergenic
1011781437 6:90794330-90794352 TGCCAAGTGCTGACCAGGCCTGG + Intergenic
1012004274 6:93693075-93693097 TGGACTTGGCTGATCAGGCATGG + Intergenic
1012873210 6:104696017-104696039 TGCAAAAGGAGGGCCAGGCACGG - Intergenic
1013105099 6:107020425-107020447 TATAAATGGTTGGCCAGGCACGG + Intergenic
1014227041 6:118861033-118861055 TGCCAATGGCAAGCCAGGCATGG + Intronic
1014392063 6:120874673-120874695 TGCCAAGGGCGAACCAGGCATGG - Intergenic
1016695814 6:146993634-146993656 TGAAAATGCATGGCCAGGCATGG - Intergenic
1018240889 6:161773383-161773405 TGCCAACTGCTGACGAGGCAGGG + Intronic
1018447763 6:163874056-163874078 GGCAAATGGGTGAGCAGGCAGGG - Intergenic
1018692259 6:166356470-166356492 AGTAAAAGGCTGGCCAGGCATGG + Intergenic
1020014551 7:4823532-4823554 TGCATTGGGCTGGCCAGGCAGGG - Intronic
1020075315 7:5254049-5254071 TGCAAATCACTGGCCAGACACGG + Intergenic
1024597636 7:50953590-50953612 AGCAAATGGCAGAACAGCCACGG + Intergenic
1025175637 7:56800486-56800508 AGCAAATAGCAGGCCAGGCATGG + Intergenic
1025203761 7:56979516-56979538 TGCAAATCACTGGCCAGACACGG - Intergenic
1025668180 7:63597414-63597436 TGCAAATCACTGGCCAGACACGG + Intergenic
1025696157 7:63775935-63775957 AGCAAATAGCAGGCCAGGCATGG - Intergenic
1025761782 7:64402694-64402716 TGCAAGTGGCTGACCTGCAATGG + Intergenic
1025913050 7:65842837-65842859 AGCAAATGGCAAGCCAGGCATGG - Intergenic
1029165039 7:98582497-98582519 TGCAAATGACCGGCCAGGCATGG + Intergenic
1029508503 7:100977856-100977878 TAGAAAAGGCTGGCCAGGCACGG - Intronic
1030423266 7:109337099-109337121 TGCAGATGGCTCTCAAGGCAAGG - Intergenic
1031950387 7:127885742-127885764 TGGGAATGGCAGAGCAGGCAAGG - Intronic
1033132767 7:138759343-138759365 TGCAAATTCCAGGCCAGGCATGG - Intronic
1033795978 7:144844976-144844998 TAAAAATCCCTGACCAGGCATGG + Intergenic
1033989173 7:147263190-147263212 TGCAAAAGGTTAGCCAGGCATGG + Intronic
1034893325 7:154859197-154859219 TGCAAATGCCTGTGCTGGCATGG - Intronic
1035709770 8:1703900-1703922 GGAACATGGCGGACCAGGCAGGG - Exonic
1036020369 8:4838044-4838066 TGTGAATGGGTGACCAGGAAGGG + Intronic
1036424230 8:8628501-8628523 TGCCACTGGCTCACCAGGGAGGG - Intergenic
1038188668 8:25298836-25298858 TGCAAATGGCAGACAAAGCCTGG - Intronic
1039059276 8:33560644-33560666 GTCAAATGCTTGACCAGGCATGG + Intronic
1039110663 8:34037923-34037945 TGCCAAAAGCTGGCCAGGCATGG - Intergenic
1039556597 8:38480584-38480606 TACAAATAGTGGACCAGGCATGG + Intergenic
1044914465 8:97097784-97097806 TGCAACTGGTTGCCCAGACAAGG + Intronic
1048338652 8:133522297-133522319 TGCAAATGGCTTCCCTGGAATGG + Intronic
1048464607 8:134655050-134655072 TGCAAGGGGCTTCCCAGGCAGGG + Intronic
1048932558 8:139326536-139326558 TGCTAATGGCTGACCGTGGAGGG + Intergenic
1049159063 8:141085847-141085869 TGCTAATGGCAGAACTGGCAAGG - Intergenic
1049161976 8:141103585-141103607 TGCAAATGGCTGGCCTGGAGGGG - Intergenic
1050493495 9:6214825-6214847 AACAGATGGCTGACCAGGCTTGG - Intergenic
1053425672 9:38008463-38008485 GGCAAATGACAGACCAGCCAGGG + Intronic
1056152145 9:83801665-83801687 TGCAAATGGCTGAAGTGGAAAGG + Intronic
1056520865 9:87400127-87400149 AACAAATGGCTGGCCAGGCATGG - Intergenic
1057578851 9:96267446-96267468 TAAAAATGGTTGGCCAGGCACGG - Intronic
1057754852 9:97825027-97825049 TGTATATGGCTGGCCAGGCATGG + Intergenic
1057788732 9:98108531-98108553 TGCAAATGCCTGAGCAGATATGG - Intronic
1059193000 9:112344841-112344863 TAAAAATGGCTAGCCAGGCACGG + Intergenic
1059323343 9:113486302-113486324 TGGAAATGGCATTCCAGGCAGGG + Intronic
1060185367 9:121560898-121560920 TCCTAATGGCTCTCCAGGCATGG + Intergenic
1060710697 9:125860990-125861012 TGAAAAAGGCAGGCCAGGCATGG + Intronic
1060870535 9:127036278-127036300 CTCCAATGGCTGACCAGGCCTGG - Intronic
1060990521 9:127846356-127846378 AGCACATGGTTGACCAGGCCGGG + Intronic
1061015418 9:127978447-127978469 AGCAAAGGGCAGACCAGGTAGGG + Intronic
1061384371 9:130279796-130279818 TGCAAATGTGTGACCTGCCATGG + Intergenic
1062344229 9:136107440-136107462 TGCCAGTGGCTACCCAGGCAGGG + Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1185468082 X:367551-367573 TGTCAATGGCTGGCCGGGCACGG - Intronic
1186235779 X:7507910-7507932 TGGAAATGGCTTCCCAGGAAAGG - Intergenic
1186473684 X:9840557-9840579 TGAAAATAGCAGGCCAGGCAAGG - Intronic
1186543039 X:10420379-10420401 TGCATTTTCCTGACCAGGCAGGG + Intergenic
1190040806 X:47070501-47070523 TGCAAAGAACTGGCCAGGCATGG + Intergenic
1190363698 X:49672332-49672354 GTCAAATGGCAGCCCAGGCAGGG - Intergenic
1192225246 X:69222944-69222966 AGCATACGGCTGAACAGGCAGGG - Intergenic
1192240166 X:69322290-69322312 TCCAGACGGTTGACCAGGCACGG + Intergenic
1198261605 X:134969779-134969801 TGCAAAGGGCTGAGCATCCAGGG + Intergenic
1198265056 X:135001369-135001391 TGCAAATTGCTGAGCATCCAGGG - Intergenic
1198917602 X:141690848-141690870 TGCAAAAATCTGGCCAGGCATGG + Intronic
1199447839 X:147946392-147946414 AGCAGATGACTGACCAAGCATGG - Intronic
1201292936 Y:12439581-12439603 ACCAAATCGTTGACCAGGCACGG + Intergenic