ID: 1119757137

View in Genome Browser
Species Human (GRCh38)
Location 14:77126987-77127009
Sequence TCTAGGGACCCCCATTTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119757129_1119757137 14 Left 1119757129 14:77126950-77126972 CCAGGGCAATCTGCCCATAATCC 0: 1
1: 0
2: 2
3: 10
4: 96
Right 1119757137 14:77126987-77127009 TCTAGGGACCCCCATTTTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 117
1119757133_1119757137 0 Left 1119757133 14:77126964-77126986 CCATAATCCTTAGCTGGGAAAGA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1119757137 14:77126987-77127009 TCTAGGGACCCCCATTTTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 117
1119757132_1119757137 1 Left 1119757132 14:77126963-77126985 CCCATAATCCTTAGCTGGGAAAG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1119757137 14:77126987-77127009 TCTAGGGACCCCCATTTTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 117
1119757135_1119757137 -7 Left 1119757135 14:77126971-77126993 CCTTAGCTGGGAAAGATCTAGGG 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1119757137 14:77126987-77127009 TCTAGGGACCCCCATTTTCCCGG 0: 1
1: 0
2: 0
3: 5
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119757137 Original CRISPR TCTAGGGACCCCCATTTTCC CGG Intronic
901613444 1:10517930-10517952 TCTAGAGTCCACCATTTGCCTGG - Intronic
902206481 1:14871879-14871901 TCTAAACACCCCCATTCTCCCGG - Intronic
902537138 1:17126046-17126068 TTTTGGGACCCTCTTTTTCCTGG + Intergenic
903193591 1:21669502-21669524 TCTCGGTGCCCCCATTTTACAGG + Intergenic
903742671 1:25567376-25567398 TCTAAGGACCCAAATTTCCCTGG + Exonic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
905652976 1:39668786-39668808 CCTTGGGACCCCCATTCTGCTGG - Intronic
908814613 1:68018967-68018989 TTTAGGGACCACTATTTGCCAGG + Intergenic
910621570 1:89261017-89261039 CCTAGGGACACCAATATTCCAGG - Intronic
914703644 1:150154380-150154402 TCCAGGGCCTCCCACTTTCCAGG - Intronic
915658862 1:157384207-157384229 TCTAGTTACTCCCATTTTCATGG + Intergenic
917977677 1:180250827-180250849 TCTAGGGAGACCCTCTTTCCTGG - Intronic
918883877 1:190165631-190165653 TCTTGAGAACCACATTTTCCTGG + Intronic
920863868 1:209735123-209735145 TTCTGGGACCTCCATTTTCCTGG - Intergenic
920948912 1:210554676-210554698 TCAAGGAAACCCCACTTTCCTGG - Intronic
1063282347 10:4644246-4644268 TCTAGGGAATCCCATTCTTCAGG + Intergenic
1064642189 10:17426273-17426295 TCTAGGTATCCCCATAATCCTGG + Intronic
1068900818 10:62268210-62268232 TCGAGGGGCTCCCATTTCCCCGG + Intronic
1071366901 10:84908918-84908940 TCTAAGGGCCCCCAGTTTTCTGG + Intergenic
1081383747 11:42446651-42446673 TCTAAGCACACCCACTTTCCAGG + Intergenic
1081792124 11:45795565-45795587 GCTAGGAACCCCCAGTTCCCAGG + Intergenic
1092112276 12:5972043-5972065 TCTAGGGACCCTCACTGACCGGG + Intronic
1092462942 12:8702030-8702052 TATGGGGACACCCATTTGCCTGG + Intronic
1093732086 12:22576599-22576621 TCTAGGGAGGCCTCTTTTCCTGG + Intergenic
1104090917 12:125517059-125517081 TCAGGGGACCCCTATTTACCTGG - Intronic
1108054060 13:46468297-46468319 TCTTGGGACCCCCATTGCCGGGG + Intergenic
1114932844 14:27495324-27495346 TGAAGAGACTCCCATTTTCCTGG - Intergenic
1116306980 14:43268681-43268703 TCTAGGGACTCTCTTTTTCTTGG + Intergenic
1116427718 14:44810613-44810635 ACTAGGGACCCACATTTCCTAGG + Intergenic
1116521087 14:45848009-45848031 TACAGGGACCCCCAGTTTTCAGG - Intergenic
1117203470 14:53416526-53416548 TTCAGGGACTCCAATTTTCCTGG + Intergenic
1118653296 14:67921165-67921187 TCTAAGGACTCTGATTTTCCAGG - Intronic
1119757137 14:77126987-77127009 TCTAGGGACCCCCATTTTCCCGG + Intronic
1126543932 15:49852279-49852301 TCTCATGATCCCCATTTTCCAGG + Intergenic
1130642423 15:85691158-85691180 ACTTGGGACACCCATTTTCCTGG + Intronic
1130992010 15:88881200-88881222 TGTTGTGACCCCCATTTTACAGG - Intronic
1131178359 15:90224022-90224044 TGTGGGGACCCACATCTTCCCGG - Intronic
1138193559 16:55035851-55035873 TCTTGGTAGCCCCATTTTACAGG + Intergenic
1141170184 16:81686054-81686076 TCTTGGCACCCCCATTTTATAGG - Intronic
1142205139 16:88779361-88779383 TCGGGGGAGCCCCATTTTCCTGG + Intronic
1143717140 17:8782197-8782219 TGTAGGGACCCCCTTATGCCTGG - Intergenic
1143762968 17:9118033-9118055 TCCAGGCTCTCCCATTTTCCAGG + Intronic
1147337852 17:39738058-39738080 TCTAGGAACCCCCAGATTCCTGG - Intronic
1149606078 17:57926053-57926075 TCTAGTTATCCCCATGTTCCAGG - Intronic
1151571589 17:74928773-74928795 TCTAGGGTCCCCCAATAGCCAGG + Intronic
1154350705 18:13580751-13580773 TCTAGGAATCTGCATTTTCCTGG + Intronic
1160418327 18:78727152-78727174 CCTCGGGACCCCGATTCTCCTGG - Intergenic
1160792912 19:930968-930990 TCCAGGAACCCGCATCTTCCTGG + Intronic
1162094441 19:8302286-8302308 TCCAGGGACCCTCAATCTCCAGG + Exonic
1164570596 19:29371903-29371925 TCTGGGGACCCCCAGGTCCCTGG - Intergenic
1164741165 19:30576438-30576460 TCTTGGGAGCCCCAGTTTCATGG + Intronic
1166298385 19:41900545-41900567 TCCAGGGACCCCCACATCCCCGG - Intronic
1167568126 19:50269806-50269828 TCTGGGGACCCTCCTTATCCTGG - Intronic
1168310635 19:55458428-55458450 TCCAGGGTCTCCCATTTCCCTGG - Intronic
1168313510 19:55473452-55473474 TCTAGGTACCCACCCTTTCCTGG - Intergenic
1168604120 19:57744486-57744508 TTTGGGGAACCCCATTTTCTTGG + Intronic
926057290 2:9781367-9781389 TTCCGGGAACCCCATTTTCCTGG - Intergenic
932257189 2:70298042-70298064 TCTAGGGACCTCTCATTTCCTGG - Intronic
939332963 2:140788396-140788418 TCTAGGGACATACATTTTCATGG + Intronic
943670741 2:190657711-190657733 GGTAGGGACACCCATTCTCCTGG + Intronic
945208107 2:207353668-207353690 CCTGGGGACCCACATTTTTCAGG + Intergenic
948858912 2:240743512-240743534 TCTCTGAGCCCCCATTTTCCAGG + Intronic
1168925180 20:1573588-1573610 TCTAGGGACACCCATGCTGCTGG - Intronic
1168929057 20:1606616-1606638 TCTAGGGACACCCATGCTGCTGG - Intronic
1172689998 20:36783664-36783686 TCTTGGGACCCCAATTCTCCAGG + Exonic
1174343804 20:49915191-49915213 CCTCAGGACCCCCATTCTCCCGG - Intronic
1175611497 20:60355153-60355175 TCCAGGGTCTCCCATTTTGCTGG - Intergenic
1176198474 20:63848556-63848578 TCCAGGGTCCCTCATCTTCCAGG - Intergenic
1176667572 21:9701603-9701625 TCCAGGAACCCACATGTTCCAGG + Intergenic
1178096399 21:29220277-29220299 TCTAGTGCCCCCCATGTGCCAGG + Intronic
1183020570 22:35023021-35023043 TCTAGGGCCCCGCCGTTTCCTGG - Intergenic
1184031520 22:41897710-41897732 GCTTGGTACCCCCATCTTCCAGG - Intronic
950585247 3:13887674-13887696 TCAAGGGCCGCCCATGTTCCAGG - Intergenic
950859628 3:16136491-16136513 GCTTGGTACCCCCATTATCCAGG + Intergenic
953853191 3:46481304-46481326 TCTTGGGACCAGCAGTTTCCTGG - Intronic
955981131 3:64528867-64528889 TCTCCCCACCCCCATTTTCCTGG + Intronic
962876271 3:139538248-139538270 TCAAGGGGCCCCCAGCTTCCTGG + Intronic
968111118 3:196047618-196047640 TCTAGGGGCCACAATTTTCGTGG + Intronic
970667465 4:18354023-18354045 TCTTGGGACCCCCTGATTCCAGG - Intergenic
971467392 4:26977906-26977928 TCTAGGTCCCCACATTCTCCTGG - Intronic
978163548 4:105579143-105579165 TCTAGGAAACCCCATAGTCCTGG - Intronic
982051319 4:151505229-151505251 ATCAGAGACCCCCATTTTCCAGG - Intronic
984459517 4:180015822-180015844 GCTTGGAACCTCCATTTTCCAGG + Intergenic
985129430 4:186725499-186725521 TCTGGGAATCCCGATTTTCCAGG + Intronic
985407234 4:189650002-189650024 TCCAGGAACCCACATGTTCCAGG - Intergenic
987591930 5:19941219-19941241 TCTAGTGAACACCCTTTTCCTGG - Intronic
991309245 5:65217054-65217076 TCTCCCGACCCCCATTTGCCTGG + Intronic
991659136 5:68932571-68932593 TCCAGGGACCCACCTGTTCCTGG + Intergenic
995208985 5:109515533-109515555 TCTGGGGAGGCCCCTTTTCCTGG + Intergenic
999944934 5:156584958-156584980 TCTAGTGCCCCACATATTCCTGG - Intronic
1003751091 6:9056940-9056962 TCTAAGGGCCTGCATTTTCCAGG - Intergenic
1006920692 6:37625308-37625330 ACTGGGGACCCCCATTACCCAGG - Intergenic
1007618717 6:43198610-43198632 ACTAGAGACCCCCATCATCCAGG + Exonic
1012647591 6:101706706-101706728 TCTAGGAATCCCCATTGGCCTGG - Intronic
1017354040 6:153481296-153481318 TATAGGTACCCCCATTGTCCTGG + Intergenic
1019564314 7:1671910-1671932 ACTTGGGTCCCTCATTTTCCTGG + Intergenic
1019747384 7:2708528-2708550 GCCGGGGACCCCCATCTTCCAGG - Intronic
1021214856 7:17903018-17903040 ACCAGGGACCCCCAGTTTCATGG - Intronic
1026020209 7:66700040-66700062 ACCAGGGACCCCCAAGTTCCTGG + Intronic
1026880107 7:73902372-73902394 ACCAGGGACCCCCAACTTCCTGG - Intergenic
1028140385 7:87267440-87267462 CTTAGGGTCCCCCATTTACCTGG + Intergenic
1028861649 7:95658759-95658781 TCCAGGGACCCCCTTTCACCTGG - Intergenic
1033154672 7:138946768-138946790 TCTAGAGACCCCCAGTTTTTTGG + Intronic
1033610291 7:142958182-142958204 CCTAGGGCCCCCCAATTTCTAGG - Intronic
1039027513 8:33273705-33273727 TCTAGTTACCTCCATTTTTCTGG - Intergenic
1043030430 8:75127719-75127741 TCTAGGGACACCCAGTCTGCTGG - Intergenic
1044930908 8:97251053-97251075 TCTAGGCAGCCCAATTTTCTTGG + Intergenic
1049251834 8:141593388-141593410 TCAAGGGGCCCCCATTGTGCAGG + Intergenic
1050602076 9:7263096-7263118 TCTAGTGATCCTCTTTTTCCTGG + Intergenic
1051716825 9:19993763-19993785 TCGAGGGACTAACATTTTCCTGG - Intergenic
1055598832 9:77894036-77894058 TCTAGTGTCCCCCATTTTAGAGG + Intronic
1058907453 9:109493501-109493523 TCATGGGACCTCAATTTTCCAGG + Intronic
1059800911 9:117748747-117748769 TCAAGGAAAGCCCATTTTCCAGG - Intergenic
1060849326 9:126861074-126861096 TCTCGGGATCCCCAGCTTCCGGG + Intronic
1062067294 9:134535622-134535644 CCCAGAGACCCCCATTCTCCTGG - Intergenic
1203658243 Un_KI270753v1:19096-19118 TCCAGGAACCCACATGTTCCAGG - Intergenic
1187911725 X:24117630-24117652 TCCAAGGAGCCCCATTTTACTGG - Intergenic
1191844315 X:65534974-65534996 TCTAGGTTCCGCCAATTTCCTGG + Intergenic
1191859211 X:65652174-65652196 TCTAGTTGCCCCCATCTTCCAGG - Intronic
1194950448 X:100119782-100119804 TCTAGGCAGCCAGATTTTCCAGG - Intergenic
1196968838 X:121086931-121086953 TGTAGGTCCACCCATTTTCCTGG + Intergenic
1197913229 X:131508180-131508202 TCTAGAAAACCCCATATTCCAGG - Intergenic
1198977463 X:142352818-142352840 GCTAGGAACCCACGTTTTCCTGG + Intergenic