ID: 1119759236

View in Genome Browser
Species Human (GRCh38)
Location 14:77139812-77139834
Sequence GACGCGCGGCACGGAGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119759236_1119759245 23 Left 1119759236 14:77139812-77139834 CCCGCTCCTCCGTGCCGCGCGTC 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1119759245 14:77139858-77139880 GCCCCCAACCCCCTGTCCCGCGG 0: 1
1: 0
2: 5
3: 35
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119759236 Original CRISPR GACGCGCGGCACGGAGGAGC GGG (reversed) Intronic
900287503 1:1908675-1908697 CACGCGCTGCAGGGAGGATCTGG + Intergenic
900534608 1:3170684-3170706 GAGGCGGGGCCCGGGGGAGCAGG + Intronic
901426127 1:9183115-9183137 GGCGCGCGGCGCTGGGGAGCCGG + Intergenic
902479650 1:16704832-16704854 GGCACGGGGCAAGGAGGAGCAGG - Intergenic
904813735 1:33180852-33180874 AACGCGGGGCAGGGAGGGGCGGG - Intronic
917962389 1:180155190-180155212 GCGGCGGGGCACGGGGGAGCGGG - Intronic
918040957 1:180913340-180913362 GACCGGCGGGGCGGAGGAGCGGG + Intronic
923097945 1:230790262-230790284 GATCTGCGGCTCGGAGGAGCAGG - Intronic
1065099633 10:22320943-22320965 GGCGCGCGGCGCGGAGGGGAGGG + Intronic
1070683335 10:78464601-78464623 GAAGTGCGGCAAGGAGGTGCTGG + Intergenic
1076859342 10:133133252-133133274 CACGTGAGACACGGAGGAGCAGG - Intergenic
1076859347 10:133133278-133133300 CACGTGAGACACGGAGGAGCAGG - Intergenic
1076859352 10:133133304-133133326 CACGTGAGACACGGAGGAGCAGG - Intergenic
1076930422 10:133528427-133528449 GCCGCGCGGCGAGGAGGTGCGGG - Intronic
1077053131 11:576625-576647 GGCCCGCGGCCCGGAGGAGCAGG - Intronic
1077142740 11:1031553-1031575 GACCCGCAGCACGGGGGGGCAGG - Intronic
1077491496 11:2862906-2862928 GACGCGCGGCGCGGTGGGGGCGG + Intergenic
1080802210 11:35619008-35619030 GAGCCGCGGCCTGGAGGAGCAGG + Exonic
1081805020 11:45885770-45885792 GGAGCGCGGCGCGGAGGAGGCGG - Exonic
1084112609 11:67023580-67023602 CAAGCGCGGCGCGGAGGTGCAGG - Intronic
1084295847 11:68213150-68213172 GACGCGCCCCGAGGAGGAGCGGG - Exonic
1091568256 12:1662958-1662980 GGGGCGGGGCACGGAAGAGCGGG - Intergenic
1092487346 12:8914406-8914428 GACGCGCGGGAGGGAGGGGGCGG + Intronic
1097053148 12:56235566-56235588 GAAGGGCGGCACGCAGGACCTGG + Exonic
1099014132 12:77324962-77324984 GAGGCGCGGCCCGGCGGAGGAGG + Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1101781895 12:107844758-107844780 GACGCGCGGCACAGGTGCGCAGG + Intergenic
1104021357 12:124994212-124994234 GAAGCGCGGCGCAGAGGAGAGGG - Intronic
1104727218 12:131085418-131085440 GGCGGGAGGCAGGGAGGAGCAGG + Intronic
1106410927 13:29511052-29511074 GGGGCACGGCAGGGAGGAGCTGG + Exonic
1109691212 13:65892153-65892175 TGCGCACAGCACGGAGGAGCCGG + Intergenic
1109922296 13:69081713-69081735 GATGAGGGGCACTGAGGAGCAGG + Intergenic
1114674134 14:24429893-24429915 GGCGCGCAGCCGGGAGGAGCTGG + Intronic
1117315354 14:54566833-54566855 GCGGCGCGGCGCGGGGGAGCCGG + Intergenic
1119759236 14:77139812-77139834 GACGCGCGGCACGGAGGAGCGGG - Intronic
1120993149 14:90396605-90396627 GACGAGGGGCACGCGGGAGCCGG + Intronic
1121011332 14:90521896-90521918 GGCGCGAGGCAGGGAGAAGCAGG - Intergenic
1121322709 14:93001843-93001865 GGCGCTGGGTACGGAGGAGCTGG - Intronic
1122595857 14:102891356-102891378 GACGTGCTGCACGGCGGAGCTGG - Exonic
1122779139 14:104136319-104136341 GGCGCGGGGCGCGGAGGACCGGG + Intergenic
1125508410 15:40280513-40280535 CACGTGCGGGACGGGGGAGCTGG + Intronic
1126087422 15:45023150-45023172 GAAGCGCCGCACGCAGGGGCGGG - Exonic
1129199799 15:73992061-73992083 GCCGCCTGGCACGGCGGAGCCGG - Intronic
1129251922 15:74313954-74313976 GACACGCGGCAAGGAGGGGCTGG - Intronic
1130224573 15:82047057-82047079 GCCGCGGGGCACGGAGGGGAGGG - Intergenic
1132783899 16:1643795-1643817 AACACGCGGCCTGGAGGAGCTGG - Intronic
1137434984 16:48447632-48447654 GACCTGGGGCACGGAGGAGCAGG + Intronic
1139355066 16:66362774-66362796 GAAGAGCGGGAAGGAGGAGCAGG - Intergenic
1140875861 16:79152190-79152212 GAGGCGAGGCCCTGAGGAGCGGG + Intronic
1141665373 16:85462908-85462930 GCGGGGCGGCACGGAGCAGCCGG - Intergenic
1142120351 16:88383698-88383720 GGCGGGCGGCCCGGAGGAGGCGG - Intergenic
1143099870 17:4499077-4499099 GGCGGGCGGCGCGGAGGAGGAGG + Exonic
1143443916 17:6996201-6996223 GACGCGCGGGGAGGCGGAGCTGG + Exonic
1148808113 17:50274359-50274381 GACTCGGGGCAGGGAGGGGCTGG - Intronic
1152521564 17:80859572-80859594 GGAGAGCGGGACGGAGGAGCCGG + Intronic
1153815366 18:8785998-8786020 CCCGCGCGGCTCGGAGGCGCAGG - Exonic
1157709890 18:49842986-49843008 GAGGCTCAGCAGGGAGGAGCTGG + Intronic
1160462109 18:79047161-79047183 GAGGCCCGGCAGGCAGGAGCTGG - Intergenic
1160613840 18:80109348-80109370 GCCGCGCGGGGCGGAGGCGCGGG + Exonic
1160733902 19:653173-653195 GACGCCCGTCACGGTGGGGCAGG - Intronic
1161089320 19:2352260-2352282 GAGGCGCTGCCCGGAGGGGCGGG - Intronic
1161543797 19:4867776-4867798 GAGGCGGGGCAGGGAGGAGAGGG - Intergenic
1162030763 19:7916403-7916425 GCCGCGGGGAACGGGGGAGCTGG - Exonic
1165129476 19:33622788-33622810 GACGCGCGCGACGGAGCCGCTGG - Intronic
1165150586 19:33758016-33758038 GACCCTCGGCAGGGAAGAGCCGG + Intronic
1202713686 1_KI270714v1_random:30738-30760 GGCACGGGGCAAGGAGGAGCAGG - Intergenic
933741713 2:85539083-85539105 GGCGCGCGGCGCCGAGGGGCGGG + Intergenic
936467271 2:112764641-112764663 GACGCGCGGCACGCCGGTCCTGG - Exonic
937083900 2:119158341-119158363 CCCGGGCGGCAAGGAGGAGCTGG - Exonic
937439859 2:121906375-121906397 GGCTCGAGGCTCGGAGGAGCTGG + Intergenic
938344756 2:130559127-130559149 GACCCTCGGCACTGAGGAGGAGG - Intergenic
938345077 2:130561593-130561615 GACCCTCGGCACTGAGGAGGAGG + Intergenic
944579062 2:201116578-201116600 GACGCGGGGCGCGGCGGCGCAGG - Intronic
948486253 2:238283137-238283159 GACAGGAGGCAAGGAGGAGCTGG + Intronic
1169195998 20:3682200-3682222 GGCGCGCGCCATGGGGGAGCCGG + Exonic
1175171775 20:57085999-57086021 CCCGCGCGGCCTGGAGGAGCCGG + Intergenic
1176096711 20:63347667-63347689 GAGACGCGGGACGGGGGAGCCGG - Intronic
1179525147 21:41971246-41971268 GAGGCCCTGCAAGGAGGAGCAGG + Intergenic
1181412994 22:22738016-22738038 GAGGCGGGGCAGGGAGGGGCTGG + Intronic
1182355297 22:29720107-29720129 CGCGCGGGGCACCGAGGAGCGGG + Exonic
1183218722 22:36498053-36498075 CACGCGCCGCACGATGGAGCTGG + Exonic
1184614657 22:45629899-45629921 GAAGCGCGGCCCTGAGCAGCTGG + Intergenic
949522339 3:4868587-4868609 GAGGCGGGGCACGGAGGGGGCGG - Intronic
952316703 3:32238495-32238517 GGCGGGCGGCGCGGAGGAGAGGG - Intergenic
953925341 3:46979799-46979821 GGCGGGCGGCGCGGAGGAGGCGG + Exonic
954150838 3:48656316-48656338 GACGCCCGGCACGCAGCGGCCGG + Exonic
954796021 3:53161679-53161701 GACGGGCCCCTCGGAGGAGCGGG - Intronic
968092905 3:195909360-195909382 GAAGCTCGGCGTGGAGGAGCGGG - Intronic
969346735 4:6575051-6575073 GAAGCTCGGGAAGGAGGAGCTGG - Intergenic
970913292 4:21304375-21304397 GAGGCCCGGCGCGGAGGAGATGG + Intronic
972475691 4:39447122-39447144 GAGGCGCGGCAGGGCCGAGCTGG - Exonic
983649779 4:170026466-170026488 GCCGGGCGGCGCGGAGGCGCGGG + Intronic
983884257 4:172962897-172962919 GAAGCGCGGCAGGCAGAAGCAGG - Intronic
993651694 5:90529716-90529738 CACGCCCGGCACGCAGGCGCAGG + Intronic
1001381416 5:171308924-171308946 GCGGCCCGGCCCGGAGGAGCGGG + Intergenic
1002095937 5:176831082-176831104 GACCCGAGGCACGGAGGTGGGGG - Intronic
1002455961 5:179345457-179345479 GAGGCGAGGCGCGGAGGGGCGGG + Intergenic
1005653129 6:27903260-27903282 GACCCGCGGGGCGGAGGTGCTGG - Intergenic
1006599136 6:35214216-35214238 GACGTCCGGCCAGGAGGAGCCGG + Intergenic
1007840542 6:44712520-44712542 GACACCCAGCAGGGAGGAGCAGG + Intergenic
1013155436 6:107488864-107488886 GAGGCGCGGGAAGGAGAAGCCGG + Intergenic
1016386681 6:143536846-143536868 GACGCCGGGCGCCGAGGAGCCGG - Intronic
1016982121 6:149863601-149863623 GCAGCGCGGCTCGGAGCAGCAGG + Exonic
1019298222 7:290105-290127 GGCGGGCGGCGCGGAGGAGGCGG + Intergenic
1034261975 7:149762967-149762989 GACGCGCTTCAGGGAGGAGGAGG - Intergenic
1034445930 7:151114517-151114539 GCGGCGCGGCGCGGGGGAGCCGG - Intronic
1034519441 7:151608040-151608062 GCAGCGCGGCACGGAGGGGAGGG + Intronic
1034680894 7:152926180-152926202 GACGTGCGGCTGGGAAGAGCTGG + Intergenic
1035168590 7:157005741-157005763 GAAGGGCGGCGCGGAGGAGCCGG - Exonic
1035291778 7:157844006-157844028 GACCCCCTGCACGGAGGAGGGGG + Intronic
1035677522 8:1465790-1465812 GAAACGCGGCACAGAGGGGCCGG - Intergenic
1038060435 8:23906329-23906351 CATCCGCGGCATGGAGGAGCTGG - Intergenic
1044569520 8:93700958-93700980 GCCGCGCTGCGCGGAGCAGCCGG + Intronic
1045277827 8:100722603-100722625 GACGCCGGGCACGGGTGAGCGGG + Exonic
1045663933 8:104466541-104466563 GCGGCGCGGCGCCGAGGAGCTGG - Intronic
1048759236 8:137773474-137773496 GAGACGCTTCACGGAGGAGCTGG + Intergenic
1049194691 8:141308625-141308647 GACGCTCGGTGCGGAGGGGCCGG - Intergenic
1049419473 8:142510570-142510592 GGCGCGGGCCCCGGAGGAGCTGG + Intronic
1049798195 8:144505927-144505949 GGTGCGCGGCGCGGGGGAGCGGG + Exonic
1049799094 8:144509543-144509565 GACGCGCAGCACGGCGGGCCTGG + Exonic
1049801252 8:144518338-144518360 GGCTCGAGGCCCGGAGGAGCCGG + Intronic
1053643473 9:40108383-40108405 AACCCGCGCCACGGAGAAGCAGG + Intergenic
1054324328 9:63705611-63705633 AACCCGCGCCACGGAGAAGCAGG + Intergenic
1054541279 9:66268221-66268243 AACCCGCGCCACGGAGAAGCAGG - Intergenic
1055315223 9:75028070-75028092 CACGCGCAGCACCGAGGAGGAGG - Exonic
1059417561 9:114171272-114171294 GCCACGCAGCACGGAGGAGGTGG + Intronic
1061028929 9:128068149-128068171 GAAGCGGGGCGCGGAGGGGCGGG + Intronic
1061933880 9:133846814-133846836 GACGGGCGGCAGGGATGAGAGGG + Intronic
1062426112 9:136507016-136507038 GACACGCGGCACGGCAGGGCCGG - Intronic
1062733628 9:138122383-138122405 GCCGTGCGGCACAGAGAAGCAGG + Exonic
1185891399 X:3825389-3825411 GGCGCAGGGCAGGGAGGAGCAGG + Intronic
1185896506 X:3863803-3863825 GGCGCAGGGCAGGGAGGAGCAGG + Intergenic
1185901624 X:3902229-3902251 GGCGCAGGGCAGGGAGGAGCAGG + Intergenic
1190050518 X:47145576-47145598 GATGCGCGGAACGGAGGGGTTGG + Intronic
1193743276 X:85244109-85244131 GACTGGCGGCACGGAGGCGGCGG + Exonic
1199815183 X:151391460-151391482 GAAGCAAGGCAAGGAGGAGCTGG - Intergenic
1200123794 X:153803874-153803896 GACGCGAGGCCTGGAGGAGCTGG - Exonic
1200155436 X:153972420-153972442 GAGGCGCGCCGCGGGGGAGCCGG + Exonic