ID: 1119762604

View in Genome Browser
Species Human (GRCh38)
Location 14:77162341-77162363
Sequence TACTAGCCTAGCCCTTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119762604_1119762610 -2 Left 1119762604 14:77162341-77162363 CCTTGGCAAGGGCTAGGCTAGTA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1119762610 14:77162362-77162384 TAAGGAAGTTGCTGGGGCAAGGG 0: 1
1: 1
2: 1
3: 35
4: 296
1119762604_1119762608 -8 Left 1119762604 14:77162341-77162363 CCTTGGCAAGGGCTAGGCTAGTA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1119762608 14:77162356-77162378 GGCTAGTAAGGAAGTTGCTGGGG 0: 1
1: 0
2: 2
3: 17
4: 198
1119762604_1119762606 -10 Left 1119762604 14:77162341-77162363 CCTTGGCAAGGGCTAGGCTAGTA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 87
1119762604_1119762607 -9 Left 1119762604 14:77162341-77162363 CCTTGGCAAGGGCTAGGCTAGTA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1119762607 14:77162355-77162377 AGGCTAGTAAGGAAGTTGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 178
1119762604_1119762609 -3 Left 1119762604 14:77162341-77162363 CCTTGGCAAGGGCTAGGCTAGTA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1119762609 14:77162361-77162383 GTAAGGAAGTTGCTGGGGCAAGG 0: 1
1: 0
2: 2
3: 18
4: 282
1119762604_1119762612 7 Left 1119762604 14:77162341-77162363 CCTTGGCAAGGGCTAGGCTAGTA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1119762612 14:77162371-77162393 TGCTGGGGCAAGGGGATAGCTGG 0: 1
1: 0
2: 3
3: 33
4: 417
1119762604_1119762611 -1 Left 1119762604 14:77162341-77162363 CCTTGGCAAGGGCTAGGCTAGTA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1119762611 14:77162363-77162385 AAGGAAGTTGCTGGGGCAAGGGG 0: 1
1: 0
2: 4
3: 47
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119762604 Original CRISPR TACTAGCCTAGCCCTTGCCA AGG (reversed) Intronic
901770756 1:11529341-11529363 TTCTAGCCCTGCCCCTGCCAAGG - Intronic
905625327 1:39486560-39486582 AACGAGCCTATCCCTTGCCAAGG - Exonic
909030979 1:70539476-70539498 TCCTAGCCTAGCCATTGAGAAGG - Intergenic
911714099 1:101110706-101110728 TTCTAGCCTAGAACTTGCCTCGG + Intergenic
913194860 1:116447388-116447410 TATTAGCCTAGGCCTAGACAGGG - Intergenic
915536602 1:156540018-156540040 AACTAGCCTAGGCCATCCCAGGG + Intronic
918403720 1:184191294-184191316 TACTAGCCAGGCCCGTTCCATGG - Intergenic
1062788026 10:281485-281507 CACGAGCCGAGCACTTGCCAAGG - Intronic
1070639099 10:78153588-78153610 CACTAGCCTGGCCCCTGTCATGG - Intergenic
1071181049 10:82984323-82984345 TTCTTGACAAGCCCTTGCCATGG + Intronic
1075551161 10:123393750-123393772 TACTACCCCAGGCCTTTCCATGG + Intergenic
1076652518 10:131999575-131999597 TTCTAGCCGAGCCCTTTCCCTGG + Intergenic
1077364268 11:2155213-2155235 AGCCAGCCCAGCCCTTGCCAGGG - Intronic
1088378562 11:109168598-109168620 TAGTCACCAAGCCCTTGCCAGGG + Intergenic
1090265333 11:125349966-125349988 TTCCAGCCTGGCCCTTCCCAGGG - Intronic
1093607607 12:21111652-21111674 TACTTGGCAACCCCTTGCCATGG - Intronic
1095671991 12:44872976-44872998 TATTAGCAAAGACCTTGCCAAGG + Intronic
1096785841 12:54016906-54016928 TAAGAGCCTAACCATTGCCAGGG + Intronic
1097853296 12:64435538-64435560 TACTACCCTGGCCACTGCCAGGG - Intronic
1100403213 12:94250243-94250265 CACAAGCCAAGCCCTTGCCATGG - Intronic
1107025228 13:35794907-35794929 TCCTAACATAGCCCTTGACAAGG - Intronic
1107447999 13:40485235-40485257 ATCTAGCCTAGCCCCTGGCATGG - Intergenic
1108529851 13:51318546-51318568 TAGTACACTAGCCCTTGTCAAGG - Intergenic
1113514463 13:110882116-110882138 TCCTATCCGAGCCCTTTCCAGGG + Intronic
1115261671 14:31460915-31460937 TACTCCACAAGCCCTTGCCATGG - Intergenic
1116605303 14:46985277-46985299 TACTAGATTATCCCTTGCCAAGG - Intronic
1117826915 14:59713653-59713675 TGCTAGTCTAGCCCTAGACAGGG + Intronic
1119762604 14:77162341-77162363 TACTAGCCTAGCCCTTGCCAAGG - Intronic
1122983542 14:105202128-105202150 TACCAGCCTAGCCCAGGCCCCGG + Intergenic
1129886110 15:79038220-79038242 GGCTAGCCTAACTCTTGCCATGG - Intronic
1130397046 15:83511850-83511872 TACCATCCTAGCCCTGTCCAGGG - Intronic
1133424821 16:5679150-5679172 CAATAGCCTTGCCCTTTCCAGGG - Intergenic
1133739835 16:8642813-8642835 AACTAGCCGTGCCCTGGCCAAGG - Intronic
1134036081 16:11032461-11032483 TACTTGCTGAGCGCTTGCCAGGG + Intronic
1136154676 16:28374803-28374825 AACTAGCCCAGCCCTTCCCCGGG + Intergenic
1136208416 16:28740455-28740477 AACTAGCCCAGCCCTTCCCCGGG - Intergenic
1136264505 16:29107131-29107153 AACTAGCCCAGCCCTTCCCCAGG - Intergenic
1137377388 16:47964233-47964255 TGCTAGCCTAGGCCTTCACAGGG - Intergenic
1138218192 16:55224179-55224201 GTCAAGCCTAGGCCTTGCCAGGG + Intergenic
1144144571 17:12384813-12384835 TACCAGCCTCTCCCTTGACATGG + Intergenic
1145112147 17:20173198-20173220 TACAAGTCTAGCCTTTGCCCTGG + Intronic
1151682444 17:75629181-75629203 TGCTAGCCCGGCCCTTGGCAAGG + Exonic
1157121286 18:44913589-44913611 TACTACTGTAGCCCTTTCCAAGG - Intronic
1158189120 18:54805295-54805317 TTCTAGCATAGCCTTTCCCACGG - Intronic
1159552062 18:69905483-69905505 AACTAGCCTTGTCCCTGCCAAGG + Intronic
929572858 2:43033631-43033653 TACCAGCCCGGCCCCTGCCAGGG + Intergenic
930403786 2:50928028-50928050 TACAAGCCTAGGTTTTGCCATGG + Intronic
933257008 2:80092715-80092737 TACTGGCCTAGCTGCTGCCAAGG + Intronic
936926870 2:117745844-117745866 TACTAGCCTTGACCTTTTCATGG - Intergenic
939177200 2:138762263-138762285 TACTAGCACATCACTTGCCATGG + Intronic
1174045564 20:47730197-47730219 TACAAGACCAGGCCTTGCCAGGG - Intronic
1175542122 20:59754489-59754511 TACTAACCTCCACCTTGCCAGGG + Intronic
1177773381 21:25542014-25542036 TTCTAGCCTACCCTTTCCCACGG + Intergenic
1178193848 21:30319755-30319777 TACGTGCCCAGGCCTTGCCAAGG - Exonic
1180594254 22:16963197-16963219 CACCAGCCTAGGCCTTTCCAGGG + Intronic
1183983092 22:41553900-41553922 TGCTAGCCTAGGCAATGCCAGGG - Intergenic
953032302 3:39186758-39186780 CACCAGCCCAGTCCTTGCCACGG + Exonic
959386849 3:105719907-105719929 TACTAGCCTAGGCCTGTACAGGG - Intronic
969589689 4:8114753-8114775 TGCTGGCCTAGCTCTTGGCAAGG - Intronic
974516346 4:62918176-62918198 TACTAGCCTAGGCCTCTACATGG + Intergenic
975077959 4:70236624-70236646 TATTAGCCTAGGCCTACCCAGGG + Intergenic
990057249 5:51598540-51598562 TACTAGCCTAGGCCTACACAGGG - Intergenic
992296139 5:75328602-75328624 CTCTACCCTAGCCCTTACCAAGG - Intergenic
996489107 5:124071556-124071578 TTCCAGCCTAGCCCTTTCCTGGG + Intergenic
997721243 5:136079722-136079744 TACCAGCCTAGACTTTCCCAAGG + Intergenic
997954102 5:138264884-138264906 TACTAGCCCTGCCCATGGCATGG - Intronic
1023662955 7:42489434-42489456 TACTACCCAATGCCTTGCCAGGG - Intergenic
1026585930 7:71656250-71656272 TGCTAGCATAGCCCTTATCACGG - Intronic
1031711481 7:125052158-125052180 CACTAGCCTAGGCCTATCCATGG + Intergenic
1036749091 8:11431993-11432015 TGTTAGACTAGCCTTTGCCAGGG - Intronic
1047553196 8:125899138-125899160 TACAAGCCAAGCACTTGCCCAGG + Intergenic
1056800873 9:89690505-89690527 TACTAGTCTACCCATTGTCATGG + Intergenic
1062254057 9:135612856-135612878 TTCTAGCCTGGCCATTACCAAGG + Intergenic
1190489954 X:50971814-50971836 TACTAGTCTAGACCTTGCTATGG + Intergenic
1197419522 X:126221584-126221606 TATTAGCCTAGGCCTACCCAAGG + Intergenic